Mutagenetix > Incidental Mutation

Incidental Mutation 'R9786:Grin2a'

734361

Institutional Source

Beutler Lab

Gene Symbol

Grin2a

Ensembl Gene

ENSMUSG00000059003

Gene Name

glutamate receptor, ionotropic, NMDA2A (epsilon 1)

Synonyms

NR2A, GluRepsilon1, NMDAR2A, GluN2A

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R9786 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9567898-9995560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 9653602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 601 (I601F)

Ref Sequence

ENSEMBL: ENSMUSP00000032331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]

AlphaFold

P35436

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032331
AA Change: I601F

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: I601F

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115835
AA Change: I601F

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: I601F

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	99	300	9.2e-11	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	1.2e-266	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199708
AA Change: I601F

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: I601F

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.2%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	T	13: 59,742,684	D441N	possibly damaging	Het
A4gnt	T	A	9: 99,620,483	M232K	possibly damaging	Het
Abcc1	T	C	16: 14,405,063	S243P	probably damaging	Het
Acsl1	T	C	8: 46,521,449	Y320H	probably damaging	Het
Adam11	A	G	11: 102,762,264	S61G	probably benign	Het
Adamts1	G	A	16: 85,795,414	T965I	probably benign	Het
Adcyap1r1	T	A	6: 55,479,197	M190K	probably damaging	Het
Ankrd2	T	A	19: 42,044,919	L300Q		Het
Ankrd27	A	T	7: 35,591,869	Q30L	possibly damaging	Het
Atp8b5	T	A	4: 43,305,798	I114K	probably damaging	Het
Atrn	A	T	2: 130,944,889	I205F	probably damaging	Het
BC035947	A	G	1: 78,511,924		probably benign	Het
Boc	C	T	16: 44,491,329	R677H		Het
D3Ertd254e	T	A	3: 36,165,704	C625*	probably null	Het
Dpysl3	G	T	18: 43,329,857	T485K	probably damaging	Het
Esyt3	T	C	9: 99,311,985	D867G	possibly damaging	Het
Fam178b	G	A	1: 36,564,436	T478I	probably damaging	Het
Fam26f	A	G	10: 34,127,647	F88S	probably benign	Het
Foxd2	G	T	4: 114,907,653	T390K	possibly damaging	Het
Furin	A	G	7: 80,390,897	V731A	probably benign	Het
Gm6583	T	A	5: 112,355,073	E255V	probably benign	Het
Hat1	G	A	2: 71,420,615	R169Q	possibly damaging	Het
Ighe	G	C	12: 113,273,231	Q6E		Het
Ighv8-2	T	C	12: 114,462,559	I31V	probably benign	Het
Klk1	A	G	7: 44,228,680	D120G	probably damaging	Het
Kmt2e	A	G	5: 23,497,984	D1054G	probably benign	Het
Lamp5	A	T	2: 136,069,078	I244F	probably damaging	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Mfsd4b1	T	C	10: 40,002,869	E344G	probably damaging	Het
Mns1	A	G	9: 72,439,274	K13R	probably benign	Het
Mrpl43	C	T	19: 45,005,907	S91N	probably benign	Het
Mtbp	T	C	15: 55,617,636	S706P	probably benign	Het
Nelfb	A	T	2: 25,205,133	V348D	probably damaging	Het
Olfr1049	G	A	2: 86,255,084	S203L	probably benign	Het
Olfr281	T	C	15: 98,456,832	I174T	possibly damaging	Het
Olfr355	T	A	2: 36,927,404	K237*	probably null	Het
Olfr497	A	T	7: 108,422,717	I49F	probably benign	Het
Olfr835	C	T	9: 19,035,945	A274V	possibly damaging	Het
Pde6c	T	C	19: 38,151,561	I324T	possibly damaging	Het
Phlpp2	T	A	8: 109,934,023	L770*	probably null	Het
Pik3c2b	T	A	1: 133,091,600	F1029I	possibly damaging	Het
Rfx2	A	T	17: 56,780,890	S500R	probably benign	Het
Sarm1	T	C	11: 78,474,917	M761V	probably benign	Het
Serpina1a	A	G	12: 103,855,881	L264P	possibly damaging	Het
Slc37a1	G	T	17: 31,337,991	G377V	probably damaging	Het
Slc38a4	T	A	15: 97,008,497	M364L	probably damaging	Het
Slc7a15	A	G	12: 8,530,280	F384S	probably benign	Het
Smyd4	T	C	11: 75,390,799	V366A	probably benign	Het
Spata31d1b	T	A	13: 59,718,341	V1101D	possibly damaging	Het
Stab2	C	A	10: 86,922,133	M1090I	probably benign	Het
Tex15	C	T	8: 33,572,429	T903I	probably damaging	Het
Tgds	A	T	14: 118,130,637	Y41*	probably null	Het
Tle4	G	T	19: 14,517,940	H142N	probably benign	Het
Tlx2	T	C	6: 83,069,293		probably null	Het
Tmem151a	C	G	19: 5,081,841	A446P	probably damaging	Het
Tmem205	A	T	9: 21,921,200	D138E	probably damaging	Het
Tmem57	A	T	4: 134,830,682	Y173*	probably null	Het
Tmprss9	A	G	10: 80,898,208	K1009E	unknown	Het
Tnk2	T	A	16: 32,680,057	C729*	probably null	Het
Trim46	T	A	3: 89,235,092	D696V	probably damaging	Het
Tuba3b	G	A	6: 145,618,756	R84Q	probably benign	Het
Unc119b	C	T	5: 115,125,462	D228N	probably damaging	Het
Usp17la	A	G	7: 104,861,657	T490A	probably benign	Het
Zfp687	C	T	3: 95,012,457	M1I	probably null	Het
Zfp729a	T	C	13: 67,620,509	T534A	possibly damaging	Het
Zfp985	A	T	4: 147,583,590	H305L	probably benign	Het
Zscan10	C	T	17: 23,609,356	Q291*	probably null	Het

Other mutations in Grin2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Grin2a	APN	16	9644130	missense	probably benign	0.29
IGL03288:Grin2a	APN	16	9669840	missense	possibly damaging	0.85
IGL02796:Grin2a	UTSW	16	9585108	missense	possibly damaging	0.72
PIT4402001:Grin2a	UTSW	16	9644199	missense	possibly damaging	0.77
PIT4494001:Grin2a	UTSW	16	9585096	missense	probably damaging	0.98
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0211:Grin2a	UTSW	16	9579173	missense	possibly damaging	0.86
R0390:Grin2a	UTSW	16	9579585	missense	possibly damaging	0.85
R0659:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0661:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0734:Grin2a	UTSW	16	9579611	missense	possibly damaging	0.71
R1524:Grin2a	UTSW	16	9663603	missense	possibly damaging	0.55
R1542:Grin2a	UTSW	16	9579203	missense	probably damaging	0.98
R1556:Grin2a	UTSW	16	9707715	missense	probably benign	0.18
R1605:Grin2a	UTSW	16	9663330	missense	possibly damaging	0.46
R1792:Grin2a	UTSW	16	9992395	missense	possibly damaging	0.53
R2024:Grin2a	UTSW	16	9644243	missense	possibly damaging	0.76
R2057:Grin2a	UTSW	16	9669744	missense	probably benign	0.14
R2344:Grin2a	UTSW	16	9663235	missense	probably benign	0.03
R2847:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2848:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2981:Grin2a	UTSW	16	9644223	missense	possibly damaging	0.89
R4197:Grin2a	UTSW	16	9761967	missense	probably damaging	1.00
R4342:Grin2a	UTSW	16	9653589	missense	possibly damaging	0.52
R4741:Grin2a	UTSW	16	9663512	missense	probably damaging	1.00
R4891:Grin2a	UTSW	16	9657706	missense	possibly damaging	0.51
R4925:Grin2a	UTSW	16	9669823	missense	probably damaging	0.98
R5563:Grin2a	UTSW	16	9707717	missense	probably benign	0.18
R5645:Grin2a	UTSW	16	9992226	missense	probably damaging	0.98
R5769:Grin2a	UTSW	16	9761526	missense	possibly damaging	0.89
R5885:Grin2a	UTSW	16	9761905	missense	possibly damaging	0.95
R6065:Grin2a	UTSW	16	9761907	missense	possibly damaging	0.92
R6083:Grin2a	UTSW	16	9579540	missense	probably benign	0.02
R6137:Grin2a	UTSW	16	9653449	missense	probably benign	0.32
R6286:Grin2a	UTSW	16	9761775	missense	possibly damaging	0.93
R6342:Grin2a	UTSW	16	9579334	missense	probably damaging	0.98
R6697:Grin2a	UTSW	16	9669840	missense	possibly damaging	0.85
R6924:Grin2a	UTSW	16	9663228	missense	possibly damaging	0.71
R7070:Grin2a	UTSW	16	9579424	missense	possibly damaging	0.92
R7235:Grin2a	UTSW	16	9579265	missense	probably damaging	0.98
R7274:Grin2a	UTSW	16	9579122	missense	possibly damaging	0.71
R7669:Grin2a	UTSW	16	9992463	missense	probably benign
R7990:Grin2a	UTSW	16	9579176	missense	possibly damaging	0.71
R8261:Grin2a	UTSW	16	9663518	missense	probably damaging	0.97
R8503:Grin2a	UTSW	16	9663549	missense	probably damaging	0.97
R8679:Grin2a	UTSW	16	9585225	missense	possibly damaging	0.90
R8700:Grin2a	UTSW	16	9579548	missense	probably benign	0.32
R8823:Grin2a	UTSW	16	9669894	missense	possibly damaging	0.96
R9122:Grin2a	UTSW	16	9579322	missense	possibly damaging	0.93
R9656:Grin2a	UTSW	16	9579607	missense	possibly damaging	0.71
R9674:Grin2a	UTSW	16	9653401	nonsense	probably null
X0024:Grin2a	UTSW	16	9663199	missense	probably benign	0.36
Z1177:Grin2a	UTSW	16	9663577	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TCCTCCTGGATCATGAAGGC -3'
(R):5'- TGCAGTAAAGTTCCAGGACAAC -3'

Sequencing Primer
(F):5'- TCATGAAGGCAGCCAGGTTG -3'
(R):5'- GAACATTGGCATGCTTTTAACTTCC -3'

Posted On

2022-11-14