Incidental Mutation 'R9787:Gli3'
ID 734414
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms brachyphalangy, Bph
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9787 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 15463235-15730026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 15725801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1258 (G1258R)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
AlphaFold Q61602
Predicted Effect probably damaging
Transcript: ENSMUST00000110510
AA Change: G1258R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: G1258R

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,501,271 T26A probably benign Het
Arhgap27 A G 11: 103,339,222 S239P possibly damaging Het
Bambi T C 18: 3,511,515 V112A possibly damaging Het
BC034090 T A 1: 155,242,209 E54D possibly damaging Het
BC052040 T A 2: 115,674,755 L169Q probably damaging Het
Chst13 C T 6: 90,309,092 R296H probably benign Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Ctbs T A 3: 146,454,354 V46E probably damaging Het
Cyp2b9 A G 7: 26,200,834 I356V probably benign Het
Dot1l A G 10: 80,764,638 T40A probably benign Het
Dst C T 1: 34,180,443 T1988M probably benign Het
Fam184a T A 10: 53,750,768 D38V possibly damaging Het
Fank1 T A 7: 133,862,158 F83I probably damaging Het
Fto T A 8: 91,485,258 W404R probably damaging Het
Gabra4 T A 5: 71,633,661 R279S possibly damaging Het
Garem2 C T 5: 30,114,221 P227L probably damaging Het
Gfra4 C A 2: 131,042,680 M1I probably null Het
Gin1 T A 1: 97,775,486 H11Q probably damaging Het
Gsx1 T C 5: 147,189,867 S167P probably damaging Het
Gtf2b AATCATC AATC 3: 142,771,417 probably benign Het
Il7 G A 3: 7,576,111 R82C probably damaging Het
Lair1 A T 7: 4,010,795 V151E probably damaging Het
Lpar1 T C 4: 58,437,349 D360G probably benign Het
Malrd1 T A 2: 15,620,590 N345K unknown Het
Mbnl1 T A 3: 60,595,665 N82K probably damaging Het
Mtdh C A 15: 34,123,698 T357N probably benign Het
Muc6 T A 7: 141,641,481 K1306* probably null Het
Nsd1 T A 13: 55,313,705 C2685S probably benign Het
Olfr2 A T 7: 107,001,692 L56H probably damaging Het
Optn T A 2: 5,031,339 Q444L probably damaging Het
Pan2 T A 10: 128,308,354 D157E probably benign Het
Pole G A 5: 110,318,000 probably null Het
Stau2 A T 1: 16,460,371 I108N unknown Het
Sugp2 A G 8: 70,242,778 K134E probably benign Het
Tcaf3 C T 6: 42,597,090 V63I probably benign Het
Tcf7 T A 11: 52,282,946 probably benign Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Tubb2b T C 13: 34,128,426 D128G probably benign Het
Umodl1 A T 17: 30,959,350 Q100L probably damaging Het
Unc79 T A 12: 103,146,361 N2230K probably benign Het
Zc3hav1l T C 6: 38,295,166 T223A probably benign Het
Zfhx4 G A 3: 5,390,446 D1167N possibly damaging Het
Zfp36 A T 7: 28,377,919 L200Q probably damaging Het
Zswim9 T A 7: 13,260,278 L650F probably damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
Capone UTSW 13 15715034 missense probably damaging 1.00
Carpals UTSW 13 15713650 critical splice donor site probably null
Ness UTSW 13 15723555 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
R7228:Gli3 UTSW 13 15724502 missense probably benign 0.00
R7327:Gli3 UTSW 13 15725559 missense probably benign 0.02
R7451:Gli3 UTSW 13 15726291 missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15726256 missense probably benign 0.00
R8167:Gli3 UTSW 13 15725643 missense probably benign 0.00
R8170:Gli3 UTSW 13 15720208 missense probably benign
R8199:Gli3 UTSW 13 15725991 missense probably benign 0.08
R8247:Gli3 UTSW 13 15726775 missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15713548 missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15723525 missense probably damaging 1.00
R8559:Gli3 UTSW 13 15660132 missense probably damaging 1.00
R8676:Gli3 UTSW 13 15715034 missense probably damaging 1.00
R8905:Gli3 UTSW 13 15726531 missense probably benign 0.01
R9099:Gli3 UTSW 13 15726735 missense probably damaging 1.00
R9260:Gli3 UTSW 13 15725090 missense probably damaging 0.99
R9317:Gli3 UTSW 13 15715073 missense probably damaging 1.00
R9475:Gli3 UTSW 13 15725711 missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15613858 missense probably benign 0.00
R9571:Gli3 UTSW 13 15726273 missense probably benign 0.00
R9621:Gli3 UTSW 13 15726668 missense probably benign 0.01
R9704:Gli3 UTSW 13 15723473 missense probably damaging 1.00
RF010:Gli3 UTSW 13 15726369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGGGTTTTGGGCTATACAAC -3'
(R):5'- TGGGCAATGTATCCCTGTCC -3'

Sequencing Primer
(F):5'- TGGGCTATACAACAATATGGTGGTAC -3'
(R):5'- TGGGTTTGCATGCCATTCAC -3'
Posted On 2022-11-14