Incidental Mutation 'R9788:Cntln'
ID 734433
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R9788 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 84968093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 771 (V771M)
Ref Sequence ENSEMBL: ENSMUSP00000044138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: V771M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: V771M

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: V771M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: V771M

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,192,253 (GRCm39) M753K probably damaging Het
Adcy7 A G 8: 89,045,733 (GRCm39) T572A probably benign Het
Bmp8b A G 4: 122,999,369 (GRCm39) M76V probably damaging Het
C2cd2 A G 16: 97,723,473 (GRCm39) S15P possibly damaging Het
Cfh T C 1: 140,036,499 (GRCm39) I702V probably benign Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Ear2 A G 14: 44,340,705 (GRCm39) Y121C probably damaging Het
Ect2l C T 10: 18,041,347 (GRCm39) C369Y possibly damaging Het
Elapor1 G A 3: 108,377,297 (GRCm39) T387I possibly damaging Het
Ephb4 T G 5: 137,363,743 (GRCm39) Y583D probably damaging Het
Gabra2 T C 5: 71,192,140 (GRCm39) D63G probably benign Het
Gfra1 A G 19: 58,441,652 (GRCm39) M93T probably damaging Het
Gm3604 A T 13: 62,519,724 (GRCm39) H10Q possibly damaging Het
Gtf2b AATCATC AATC 3: 142,477,178 (GRCm39) probably benign Het
Herc1 A C 9: 66,307,185 (GRCm39) I1002L probably benign Het
Hmcn1 T C 1: 150,528,333 (GRCm39) I3272V probably benign Het
Izumo3 A G 4: 92,035,037 (GRCm39) I60T probably benign Het
Jakmip2 T A 18: 43,704,927 (GRCm39) N358I probably damaging Het
Klra9 T A 6: 130,159,385 (GRCm39) K209N possibly damaging Het
Ldah A T 12: 8,333,946 (GRCm39) Y279F possibly damaging Het
Lrrcc1 T A 3: 14,602,286 (GRCm39) H126Q probably damaging Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mipep A G 14: 61,083,893 (GRCm39) T595A probably damaging Het
Mms22l A G 4: 24,586,204 (GRCm39) T859A probably benign Het
Mogat1 A G 1: 78,499,342 (GRCm39) M39V probably benign Het
Muc6 T C 7: 141,232,100 (GRCm39) D968G probably damaging Het
Nab1 T C 1: 52,529,166 (GRCm39) K244E possibly damaging Het
Nr1h4 A G 10: 89,314,638 (GRCm39) probably null Het
Nxph1 A G 6: 9,247,418 (GRCm39) T130A probably damaging Het
Obscn A G 11: 58,969,678 (GRCm39) V2426A possibly damaging Het
Or10j7 C T 1: 173,011,458 (GRCm39) R181H probably benign Het
Or11l3 T A 11: 58,516,692 (GRCm39) Y60F probably benign Het
Or1e31 T C 11: 73,689,768 (GRCm39) T272A probably benign Het
Or4m1 A G 14: 50,558,181 (GRCm39) F37S probably benign Het
Or5p4 T C 7: 107,680,745 (GRCm39) V248A probably damaging Het
Or8g21 A G 9: 38,906,296 (GRCm39) V145A possibly damaging Het
Osbpl3 A G 6: 50,324,344 (GRCm39) probably null Het
Otop3 T A 11: 115,235,087 (GRCm39) C259S unknown Het
Pcsk5 A G 19: 17,455,245 (GRCm39) Y1062H probably benign Het
Phf21a T C 2: 92,181,978 (GRCm39) probably null Het
Plch1 T C 3: 63,681,136 (GRCm39) I164V probably benign Het
Plekhh2 T A 17: 84,854,892 (GRCm39) M42K possibly damaging Het
Plekhm3 T C 1: 64,961,422 (GRCm39) D278G possibly damaging Het
Plod3 A G 5: 137,019,911 (GRCm39) Y447C probably damaging Het
Psg16 T C 7: 16,824,524 (GRCm39) S12P possibly damaging Het
Ptprq A T 10: 107,401,751 (GRCm39) C1914S probably benign Het
Rai1 A G 11: 60,078,080 (GRCm39) T715A possibly damaging Het
Rsad2 G A 12: 26,500,577 (GRCm39) H237Y probably benign Het
Sarm1 A G 11: 78,378,863 (GRCm39) L394P probably damaging Het
Scube1 A G 15: 83,535,901 (GRCm39) S258P possibly damaging Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc22a26 G A 19: 7,763,798 (GRCm39) P412S probably benign Het
Son TATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGTTCCATGGACTCCCAGATGTTAGCA TATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGTTCCATGGACTCCCAGATGTTAGCA 16: 91,453,699 (GRCm39) probably benign Het
Synrg A T 11: 83,877,781 (GRCm39) H342L probably benign Het
Tenm3 T C 8: 48,788,596 (GRCm39) Y478C probably benign Het
Tlr9 C T 9: 106,101,006 (GRCm39) P99L probably damaging Het
Trip4 T C 9: 65,740,702 (GRCm39) E535G probably benign Het
Utp20 A G 10: 88,653,171 (GRCm39) L303P probably damaging Het
Vmn2r2 T C 3: 64,041,942 (GRCm39) N258D possibly damaging Het
Zfp616 G A 11: 73,975,276 (GRCm39) G515D probably damaging Het
Zfp786 A G 6: 47,797,816 (GRCm39) L374P probably benign Het
Zfp82 C T 7: 29,755,963 (GRCm39) R373H probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCATTGAGTTGGAAAATCGGC -3'
(R):5'- AGCACTTTCTCTTGGCAGC -3'

Sequencing Primer
(F):5'- TGAGTTGGAAAATCGGCTAAAATC -3'
(R):5'- GGCAGCTTTAAATTTCACCTTGG -3'
Posted On 2022-11-14