Mutagenetix > Incidental Mutation

Incidental Mutation 'R9788:Tlr9'

734454

Institutional Source

Beutler Lab

Gene Symbol

Tlr9

Ensembl Gene

ENSMUSG00000045322

Gene Name

toll-like receptor 9

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R9788 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106222598-106226883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 106223807 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 99 (P99L)

Ref Sequence

ENSEMBL: ENSMUSP00000082207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062241]

AlphaFold

Q9EQU3

PDB Structure

Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062241
AA Change: P99L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: P99L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	G	A	3: 108,469,981	T387I	possibly damaging	Het
Abca5	A	T	11: 110,301,427	M753K	probably damaging	Het
Adcy7	A	G	8: 88,319,105	T572A	probably benign	Het
Bmp8b	A	G	4: 123,105,576	M76V	probably damaging	Het
C2cd2	A	G	16: 97,922,273	S15P	possibly damaging	Het
Cfh	T	C	1: 140,108,761	I702V	probably benign	Het
Clip2	C	T	5: 134,504,762	R487Q	probably benign	Het
Cntln	G	A	4: 85,049,856	V771M	probably damaging	Het
Ear2	A	G	14: 44,103,248	Y121C	probably damaging	Het
Ect2l	C	T	10: 18,165,599	C369Y	possibly damaging	Het
Ephb4	T	G	5: 137,365,481	Y583D	probably damaging	Het
Gabra2	T	C	5: 71,034,797	D63G	probably benign	Het
Gfra1	A	G	19: 58,453,220	M93T	probably damaging	Het
Gm3604	A	T	13: 62,371,910	H10Q	possibly damaging	Het
Gtf2b	AATCATC	AATC	3: 142,771,417		probably benign	Het
Herc1	A	C	9: 66,399,903	I1002L	probably benign	Het
Hmcn1	T	C	1: 150,652,582	I3272V	probably benign	Het
Izumo3	A	G	4: 92,146,800	I60T	probably benign	Het
Jakmip2	T	A	18: 43,571,862	N358I	probably damaging	Het
Klra9	T	A	6: 130,182,422	K209N	possibly damaging	Het
Ldah	A	T	12: 8,283,946	Y279F	possibly damaging	Het
Lrrcc1	T	A	3: 14,537,226	H126Q	probably damaging	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Mipep	A	G	14: 60,846,444	T595A	probably damaging	Het
Mms22l	A	G	4: 24,586,204	T859A	probably benign	Het
Mogat1	A	G	1: 78,522,705	M39V	probably benign	Het
Muc6	T	C	7: 141,645,833	D968G	probably damaging	Het
Nab1	T	C	1: 52,490,007	K244E	possibly damaging	Het
Nr1h4	A	G	10: 89,478,776		probably null	Het
Nxph1	A	G	6: 9,247,418	T130A	probably damaging	Het
Obscn	A	G	11: 59,078,852	V2426A	possibly damaging	Het
Olfr1406	C	T	1: 173,183,891	R181H	probably benign	Het
Olfr323	T	A	11: 58,625,866	Y60F	probably benign	Het
Olfr391-ps	T	C	11: 73,798,942	T272A	probably benign	Het
Olfr481	T	C	7: 108,081,538	V248A	probably damaging	Het
Olfr734	A	G	14: 50,320,724	F37S	probably benign	Het
Olfr935	A	G	9: 38,995,000	V145A	possibly damaging	Het
Osbpl3	A	G	6: 50,347,364		probably null	Het
Otop3	T	A	11: 115,344,261	C259S	unknown	Het
Pcsk5	A	G	19: 17,477,881	Y1062H	probably benign	Het
Phf21a	T	C	2: 92,351,633		probably null	Het
Plch1	T	C	3: 63,773,715	I164V	probably benign	Het
Plekhh2	T	A	17: 84,547,464	M42K	possibly damaging	Het
Plekhm3	T	C	1: 64,922,263	D278G	possibly damaging	Het
Plod3	A	G	5: 136,991,057	Y447C	probably damaging	Het
Psg16	T	C	7: 17,090,599	S12P	possibly damaging	Het
Ptprq	A	T	10: 107,565,890	C1914S	probably benign	Het
Rai1	A	G	11: 60,187,254	T715A	possibly damaging	Het
Rsad2	G	A	12: 26,450,578	H237Y	probably benign	Het
Sarm1	A	G	11: 78,488,037	L394P	probably damaging	Het
Scube1	A	G	15: 83,651,700	S258P	possibly damaging	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc22a26	G	A	19: 7,786,433	P412S	probably benign	Het
Son	TATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGTTCCATGGACTCCCAGATGTTAGCA	TATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGTTCCATGGACTCCCAGATGTTAGCA	16: 91,656,811		probably benign	Het
Synrg	A	T	11: 83,986,955	H342L	probably benign	Het
Tenm3	T	C	8: 48,335,561	Y478C	probably benign	Het
Trip4	T	C	9: 65,833,420	E535G	probably benign	Het
Utp20	A	G	10: 88,817,309	L303P	probably damaging	Het
Vmn2r2	T	C	3: 64,134,521	N258D	possibly damaging	Het
Zfp616	G	A	11: 74,084,450	G515D	probably damaging	Het
Zfp786	A	G	6: 47,820,882	L374P	probably benign	Het
Zfp82	C	T	7: 30,056,538	R373H	probably damaging	Het

Other mutations in Tlr9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Tlr9	APN	9	106225007	missense	probably damaging	1.00
IGL01764:Tlr9	APN	9	106225805	missense	probably damaging	1.00
IGL02077:Tlr9	APN	9	106225505	missense	possibly damaging	0.90
IGL02232:Tlr9	APN	9	106224937	missense	probably damaging	1.00
IGL02851:Tlr9	APN	9	106224730	nonsense	probably null
Asura	UTSW	9	106224647	missense	probably damaging	1.00
Cpg1	UTSW	9	106225007	missense	probably damaging	1.00
Cpg11	UTSW	9	106224586	missense	probably damaging	1.00
Cpg2	UTSW	9	106226465	missense	probably damaging	1.00
Cpg3	UTSW	9	106224152	missense	probably damaging	1.00
Cpg5	UTSW	9	106224689	missense	probably damaging	1.00
Cpg6	UTSW	9	106226593	missense	probably damaging	1.00
cpg7	UTSW	9	106225349	missense	probably benign	0.00
Meager	UTSW	9	106224139	missense	probably damaging	1.00
PIT4498001:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0126:Tlr9	UTSW	9	106225682	missense	probably benign	0.01
R0165:Tlr9	UTSW	9	106226087	missense	probably benign	0.10
R0534:Tlr9	UTSW	9	106224887	missense	probably benign	0.01
R0585:Tlr9	UTSW	9	106225076	missense	probably benign	0.01
R1527:Tlr9	UTSW	9	106223750	missense	probably benign	0.09
R1712:Tlr9	UTSW	9	106224049	missense	probably damaging	1.00
R1817:Tlr9	UTSW	9	106224943	missense	probably benign
R1940:Tlr9	UTSW	9	106224647	missense	probably damaging	1.00
R2117:Tlr9	UTSW	9	106225337	missense	probably damaging	1.00
R2656:Tlr9	UTSW	9	106223941	missense	probably benign	0.05
R3700:Tlr9	UTSW	9	106224079	missense	probably damaging	1.00
R4600:Tlr9	UTSW	9	106224533	missense	probably damaging	1.00
R4608:Tlr9	UTSW	9	106224974	missense	probably damaging	0.99
R4612:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
R4959:Tlr9	UTSW	9	106224677	missense	probably benign
R5173:Tlr9	UTSW	9	106225952	missense	possibly damaging	0.49
R5472:Tlr9	UTSW	9	106224313	missense	probably damaging	1.00
R5572:Tlr9	UTSW	9	106225637	missense	possibly damaging	0.47
R5618:Tlr9	UTSW	9	106224739	missense	possibly damaging	0.47
R5820:Tlr9	UTSW	9	106222707	critical splice donor site	probably null
R6393:Tlr9	UTSW	9	106224937	missense	probably damaging	1.00
R6397:Tlr9	UTSW	9	106225106	missense	probably damaging	1.00
R6455:Tlr9	UTSW	9	106223999	missense	probably damaging	1.00
R7385:Tlr9	UTSW	9	106225264	missense	probably damaging	1.00
R7455:Tlr9	UTSW	9	106224530	missense	probably benign	0.00
R7561:Tlr9	UTSW	9	106225949	missense	probably benign	0.00
R8889:Tlr9	UTSW	9	106222635	start gained	probably benign
R8892:Tlr9	UTSW	9	106222635	start gained	probably benign
R8926:Tlr9	UTSW	9	106226014	missense	probably benign
R9221:Tlr9	UTSW	9	106224773	missense	probably damaging	1.00
R9228:Tlr9	UTSW	9	106225553	missense	possibly damaging	0.49
R9581:Tlr9	UTSW	9	106224311	missense	probably damaging	1.00
R9689:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R9697:Tlr9	UTSW	9	106223524	nonsense	probably null
Z1176:Tlr9	UTSW	9	106223663	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGTGAGCTGAAGCCTCATG -3'
(R):5'- AGAACGCGCAGGCTGTATAG -3'

Sequencing Primer
(F):5'- CTCATGGCCTGGTGGACTG -3'
(R):5'- CTGTTAGCATCTAGAACCAGGATG -3'

Posted On

2022-11-14