Incidental Mutation 'R9788:Jakmip2'
ID 734478
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock # R9788 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 43531408-43687773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43571862 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 358 (N358I)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably damaging
Transcript: ENSMUST00000082254
AA Change: N358I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: N358I

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,469,981 T387I possibly damaging Het
Abca5 A T 11: 110,301,427 M753K probably damaging Het
Adcy7 A G 8: 88,319,105 T572A probably benign Het
Bmp8b A G 4: 123,105,576 M76V probably damaging Het
C2cd2 A G 16: 97,922,273 S15P possibly damaging Het
Cfh T C 1: 140,108,761 I702V probably benign Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Cntln G A 4: 85,049,856 V771M probably damaging Het
Ear2 A G 14: 44,103,248 Y121C probably damaging Het
Ect2l C T 10: 18,165,599 C369Y possibly damaging Het
Ephb4 T G 5: 137,365,481 Y583D probably damaging Het
Gabra2 T C 5: 71,034,797 D63G probably benign Het
Gfra1 A G 19: 58,453,220 M93T probably damaging Het
Gm3604 A T 13: 62,371,910 H10Q possibly damaging Het
Gtf2b AATCATC AATC 3: 142,771,417 probably benign Het
Herc1 A C 9: 66,399,903 I1002L probably benign Het
Hmcn1 T C 1: 150,652,582 I3272V probably benign Het
Izumo3 A G 4: 92,146,800 I60T probably benign Het
Klra9 T A 6: 130,182,422 K209N possibly damaging Het
Ldah A T 12: 8,283,946 Y279F possibly damaging Het
Lrrcc1 T A 3: 14,537,226 H126Q probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mipep A G 14: 60,846,444 T595A probably damaging Het
Mms22l A G 4: 24,586,204 T859A probably benign Het
Mogat1 A G 1: 78,522,705 M39V probably benign Het
Muc6 T C 7: 141,645,833 D968G probably damaging Het
Nab1 T C 1: 52,490,007 K244E possibly damaging Het
Nr1h4 A G 10: 89,478,776 probably null Het
Nxph1 A G 6: 9,247,418 T130A probably damaging Het
Obscn A G 11: 59,078,852 V2426A possibly damaging Het
Olfr1406 C T 1: 173,183,891 R181H probably benign Het
Olfr323 T A 11: 58,625,866 Y60F probably benign Het
Olfr391-ps T C 11: 73,798,942 T272A probably benign Het
Olfr481 T C 7: 108,081,538 V248A probably damaging Het
Olfr734 A G 14: 50,320,724 F37S probably benign Het
Olfr935 A G 9: 38,995,000 V145A possibly damaging Het
Osbpl3 A G 6: 50,347,364 probably null Het
Otop3 T A 11: 115,344,261 C259S unknown Het
Pcsk5 A G 19: 17,477,881 Y1062H probably benign Het
Phf21a T C 2: 92,351,633 probably null Het
Plch1 T C 3: 63,773,715 I164V probably benign Het
Plekhh2 T A 17: 84,547,464 M42K possibly damaging Het
Plekhm3 T C 1: 64,922,263 D278G possibly damaging Het
Plod3 A G 5: 136,991,057 Y447C probably damaging Het
Psg16 T C 7: 17,090,599 S12P possibly damaging Het
Ptprq A T 10: 107,565,890 C1914S probably benign Het
Rai1 A G 11: 60,187,254 T715A possibly damaging Het
Rsad2 G A 12: 26,450,578 H237Y probably benign Het
Sarm1 A G 11: 78,488,037 L394P probably damaging Het
Scube1 A G 15: 83,651,700 S258P possibly damaging Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc22a26 G A 19: 7,786,433 P412S probably benign Het
Son TATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGTTCCATGGACTCCCAGATGTTAGCA TATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGTTCCATGGACTCCCAGATGTTAGCA 16: 91,656,811 probably benign Het
Synrg A T 11: 83,986,955 H342L probably benign Het
Tenm3 T C 8: 48,335,561 Y478C probably benign Het
Tlr9 C T 9: 106,223,807 P99L probably damaging Het
Trip4 T C 9: 65,833,420 E535G probably benign Het
Utp20 A G 10: 88,817,309 L303P probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Zfp616 G A 11: 74,084,450 G515D probably damaging Het
Zfp786 A G 6: 47,820,882 L374P probably benign Het
Zfp82 C T 7: 30,056,538 R373H probably damaging Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43590679 utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43557324 splice site probably benign
IGL01467:Jakmip2 APN 18 43582287 missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43547094 missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43559093 critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43571854 missense probably benign
IGL02143:Jakmip2 APN 18 43563285 missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43567158 missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43562590 missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43575451 splice site probably benign
IGL02866:Jakmip2 APN 18 43552201 missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43562530 critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43552145 splice site probably benign
R0044:Jakmip2 UTSW 18 43582105 missense probably benign
R0436:Jakmip2 UTSW 18 43558169 nonsense probably null
R1453:Jakmip2 UTSW 18 43559214 splice site probably null
R1682:Jakmip2 UTSW 18 43581831 critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43582080 missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43567144 missense probably benign
R2070:Jakmip2 UTSW 18 43563330 missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43565930 missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43571181 missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43549686 missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43562592 missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43577412 missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43567143 missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43577400 missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43568108 missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43581960 missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43559116 missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43581994 missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43575534 missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43571179 missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43556524 missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43557367 missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43565949 missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43557328 critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43540583 splice site probably null
R7434:Jakmip2 UTSW 18 43557379 missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43577325 missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43571126 missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43540611 missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43571908 missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43563333 missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43582258 missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43582287 missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43552177 missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43582129 missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43571896 missense probably benign
R9691:Jakmip2 UTSW 18 43540620 missense probably damaging 0.99
X0057:Jakmip2 UTSW 18 43565970 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGCTCCTTCCACTCTGCAAG -3'
(R):5'- ACCCTATTTCCCTCAAGATACGAG -3'

Sequencing Primer
(F):5'- TTCCACTCTGCAAGGTTAGAAAC -3'
(R):5'- AAACCTCTCCTGGAAAGG -3'
Posted On 2022-11-14