Incidental Mutation 'R9789:Cnot1'
ID 734533
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9789 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 95719451-95807464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95729144 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1995 (E1995G)
Ref Sequence ENSEMBL: ENSMUSP00000063565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068452
AA Change: E1995G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: E1995G

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098473
AA Change: E2000G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: E2000G

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211887
AA Change: E1993G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,184,583 S1038R probably benign Het
Aar2 T C 2: 156,550,825 F45L probably damaging Het
Abcg2 A G 6: 58,664,548 Y122C probably damaging Het
Arfgef1 A T 1: 10,173,202 W1041R probably damaging Het
Ash1l A G 3: 88,966,066 N52S probably benign Het
Asrgl1 T A 19: 9,116,610 T185S probably damaging Het
Astl T A 2: 127,350,226 S234T probably damaging Het
Atp5j2 T C 5: 145,183,846 Y87C probably damaging Het
Atxn7l1 A T 12: 33,346,063 R264W probably damaging Het
Axin2 T C 11: 108,949,354 Y828H probably damaging Het
Bnipl T C 3: 95,245,829 D145G possibly damaging Het
C8b A T 4: 104,782,994 M165L probably benign Het
Cd109 T C 9: 78,634,662 L87P possibly damaging Het
Cdk17 C T 10: 93,225,029 P232S probably damaging Het
Csf2rb2 G A 15: 78,284,996 A653V probably benign Het
Cutc A G 19: 43,768,260 N264D probably benign Het
Cxcr4 C T 1: 128,589,147 W259* probably null Het
Dnah8 T C 17: 30,761,130 probably null Het
Dsp T C 13: 38,183,961 I652T probably benign Het
Dstyk A T 1: 132,454,121 M538L probably benign Het
Eppk1 T A 15: 76,109,019 I1221F probably benign Het
Ern2 T A 7: 122,170,262 Y847F probably damaging Het
Exosc7 T A 9: 123,130,925 V197D probably damaging Het
Gabra1 T C 11: 42,133,525 Y441C probably damaging Het
Garem1 G A 18: 21,129,928 P610S possibly damaging Het
Garem2 T A 5: 30,114,332 V264E probably damaging Het
Gata2 G A 6: 88,200,290 G101S probably benign Het
Gcnt4 A G 13: 96,946,921 T242A probably benign Het
Ghitm A C 14: 37,130,762 Y120* probably null Het
Gimap7 A G 6: 48,723,536 S19G probably damaging Het
Gm5475 G A 15: 100,427,000 G103E unknown Het
Gstcd A T 3: 133,084,596 C137S probably damaging Het
Gtf2b AATCATC AATC 3: 142,771,417 probably benign Het
Hfm1 T C 5: 106,917,480 D111G probably benign Het
Ighg2b A G 12: 113,306,684 I238T Het
Il2ra A C 2: 11,680,350 M166L probably benign Het
Itga1 A T 13: 115,035,284 L95* probably null Het
Itpr3 A G 17: 27,089,941 T373A probably benign Het
Klhl28 A G 12: 64,950,097 V490A probably damaging Het
Kntc1 A T 5: 123,760,643 N200I possibly damaging Het
L3mbtl4 A G 17: 68,459,799 K167R probably benign Het
Lgals1 A T 15: 78,929,730 T63S probably benign Het
Lnpep C A 17: 17,575,334 C305F probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mcmbp A G 7: 128,709,859 I310T possibly damaging Het
Mical2 G A 7: 112,346,789 R986H probably damaging Het
Muc5b A T 7: 141,861,593 S2759C possibly damaging Het
Myh7 A G 14: 54,991,927 V138A possibly damaging Het
Ncr1 T G 7: 4,341,301 probably null Het
Ndufa10 A T 1: 92,469,888 D145E possibly damaging Het
Neo1 T A 9: 58,894,024 probably null Het
Ninl A T 2: 150,949,781 S941T probably benign Het
Nrm T A 17: 35,861,519 probably null Het
Nup214 T C 2: 32,017,215 V1018A possibly damaging Het
Odf1 A G 15: 38,219,472 I15V probably benign Het
Olfr1023 C T 2: 85,886,994 H65Y probably damaging Het
Olfr118 T A 17: 37,672,168 N48K probably damaging Het
Olfr1406 C T 1: 173,183,891 R181H probably benign Het
Olfr32 T A 2: 90,138,660 T160S probably benign Het
Olfr376 A T 11: 73,374,884 N48I probably damaging Het
Olfr490 A T 7: 108,286,691 V145D probably benign Het
Olfr670 A T 7: 104,960,450 I94N probably damaging Het
Olfr850 C A 9: 19,478,086 D55Y probably benign Het
Osgin2 A T 4: 15,998,957 Y222N probably damaging Het
Pcdhga10 T C 18: 37,749,310 V708A probably benign Het
Pfn3 T C 13: 55,415,087 D27G possibly damaging Het
Plch2 A G 4: 155,010,865 probably null Het
Plin2 C A 4: 86,658,677 Q270H probably damaging Het
Polk A G 13: 96,493,895 F386S probably damaging Het
Prkar1a G A 11: 109,665,952 G286E probably damaging Het
Prodh A T 16: 18,080,185 L276Q probably damaging Het
Ranbp10 T C 8: 105,786,674 N202S probably damaging Het
Rapgef6 C A 11: 54,649,271 T724K probably benign Het
Rnf144a T A 12: 26,327,575 K56N probably benign Het
Rpa1 T A 11: 75,313,112 K303I probably damaging Het
Slc16a9 A C 10: 70,282,510 N220H possibly damaging Het
Slc28a3 T C 13: 58,576,850 I197V probably benign Het
Slc35d1 A T 4: 103,214,749 F19I Het
Sohlh2 A T 3: 55,192,300 E164D probably damaging Het
Sord A T 2: 122,263,284 K295* probably null Het
Spata31d1b A G 13: 59,712,382 Y23C probably benign Het
Stard9 T A 2: 120,679,936 Y333N probably damaging Het
Tas2r107 A G 6: 131,659,790 F99L probably damaging Het
Thap12 C T 7: 98,703,385 probably benign Het
Tmprss9 A T 10: 80,895,159 T840S probably benign Het
Trim16 T A 11: 62,829,200 probably null Het
Ttc16 C T 2: 32,774,793 probably null Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Unc80 A T 1: 66,612,212 Y1572F possibly damaging Het
Usp42 G T 5: 143,720,305 A320D possibly damaging Het
Vmn2r94 T C 17: 18,243,776 T751A probably damaging Het
Zbtb41 C T 1: 139,440,346 L591F probably damaging Het
Zdhhc5 T A 2: 84,694,318 E219D probably damaging Het
Zfp248 A T 6: 118,429,051 F526I probably damaging Het
Zfp322a T C 13: 23,356,388 K395E possibly damaging Het
Zfp423 G A 8: 87,780,249 P1156S probably benign Het
Zfp644 T C 5: 106,638,265 T139A possibly damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Affiliate UTSW 8 95765125 missense probably damaging 0.99
Barge UTSW 8 95734129 missense probably benign 0.13
Byproduct UTSW 8 95745647 frame shift probably null
Chairman UTSW 8 95765027 missense possibly damaging 0.95
cohort UTSW 8 95735749 missense probably damaging 0.99
Director UTSW 8 95765062 missense probably benign 0.15
kowloon UTSW 8 95788658 missense probably damaging 1.00
Quorum UTSW 8 95726118 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
BB001:Cnot1 UTSW 8 95745647 frame shift probably null
BB003:Cnot1 UTSW 8 95745647 frame shift probably null
BB011:Cnot1 UTSW 8 95745647 frame shift probably null
BB013:Cnot1 UTSW 8 95745647 frame shift probably null
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7914:Cnot1 UTSW 8 95745647 frame shift probably null
R7924:Cnot1 UTSW 8 95745647 frame shift probably null
R7926:Cnot1 UTSW 8 95745647 frame shift probably null
R7981:Cnot1 UTSW 8 95763169 missense probably damaging 1.00
R8004:Cnot1 UTSW 8 95752752 missense probably benign 0.03
R8061:Cnot1 UTSW 8 95765027 missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 95761351 missense probably damaging 1.00
R8269:Cnot1 UTSW 8 95751761 missense probably damaging 1.00
R8306:Cnot1 UTSW 8 95747021 missense probably benign 0.05
R8322:Cnot1 UTSW 8 95769844 missense probably benign 0.00
R8427:Cnot1 UTSW 8 95734324 missense probably benign 0.01
R8723:Cnot1 UTSW 8 95736279 missense probably benign 0.00
R8934:Cnot1 UTSW 8 95765067 missense probably benign 0.04
R9025:Cnot1 UTSW 8 95749032 missense probably benign
R9179:Cnot1 UTSW 8 95773426 missense probably benign 0.16
R9280:Cnot1 UTSW 8 95770599 missense probably benign 0.15
R9285:Cnot1 UTSW 8 95726118 missense probably damaging 1.00
R9299:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
R9337:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
R9480:Cnot1 UTSW 8 95770710 missense possibly damaging 0.94
R9548:Cnot1 UTSW 8 95756226 missense probably benign 0.02
R9601:Cnot1 UTSW 8 95756207 missense probably benign 0.02
R9629:Cnot1 UTSW 8 95729246 missense probably damaging 0.98
R9752:Cnot1 UTSW 8 95761391 missense probably damaging 1.00
R9764:Cnot1 UTSW 8 95769581 missense probably benign 0.00
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGATCCCAGCACAACCTCTG -3'
(R):5'- GGGCCTAGGTTCAATCCAAGAC -3'

Sequencing Primer
(F):5'- CAACTCTTGGACGCTCGAATTGG -3'
(R):5'- TAGGTTCAATCCAAGACACAGG -3'
Posted On 2022-11-14