Incidental Mutation 'R9789:Itpr3'
ID 734572
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms tf, Ip3r3, Itpr-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9789 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 27057304-27122223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27089941 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 373 (T373A)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
AlphaFold P70227
PDB Structure Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049308
AA Change: T373A

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: T373A

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,184,583 S1038R probably benign Het
Aar2 T C 2: 156,550,825 F45L probably damaging Het
Abcg2 A G 6: 58,664,548 Y122C probably damaging Het
Arfgef1 A T 1: 10,173,202 W1041R probably damaging Het
Ash1l A G 3: 88,966,066 N52S probably benign Het
Asrgl1 T A 19: 9,116,610 T185S probably damaging Het
Astl T A 2: 127,350,226 S234T probably damaging Het
Atp5j2 T C 5: 145,183,846 Y87C probably damaging Het
Atxn7l1 A T 12: 33,346,063 R264W probably damaging Het
Axin2 T C 11: 108,949,354 Y828H probably damaging Het
Bnipl T C 3: 95,245,829 D145G possibly damaging Het
C8b A T 4: 104,782,994 M165L probably benign Het
Cd109 T C 9: 78,634,662 L87P possibly damaging Het
Cdk17 C T 10: 93,225,029 P232S probably damaging Het
Cnot1 T C 8: 95,729,144 E1995G probably damaging Het
Csf2rb2 G A 15: 78,284,996 A653V probably benign Het
Cutc A G 19: 43,768,260 N264D probably benign Het
Cxcr4 C T 1: 128,589,147 W259* probably null Het
Dnah8 T C 17: 30,761,130 probably null Het
Dsp T C 13: 38,183,961 I652T probably benign Het
Dstyk A T 1: 132,454,121 M538L probably benign Het
Eppk1 T A 15: 76,109,019 I1221F probably benign Het
Ern2 T A 7: 122,170,262 Y847F probably damaging Het
Exosc7 T A 9: 123,130,925 V197D probably damaging Het
Gabra1 T C 11: 42,133,525 Y441C probably damaging Het
Garem1 G A 18: 21,129,928 P610S possibly damaging Het
Garem2 T A 5: 30,114,332 V264E probably damaging Het
Gata2 G A 6: 88,200,290 G101S probably benign Het
Gcnt4 A G 13: 96,946,921 T242A probably benign Het
Ghitm A C 14: 37,130,762 Y120* probably null Het
Gimap7 A G 6: 48,723,536 S19G probably damaging Het
Gm5475 G A 15: 100,427,000 G103E unknown Het
Gstcd A T 3: 133,084,596 C137S probably damaging Het
Gtf2b AATCATC AATC 3: 142,771,417 probably benign Het
Hfm1 T C 5: 106,917,480 D111G probably benign Het
Ighg2b A G 12: 113,306,684 I238T Het
Il2ra A C 2: 11,680,350 M166L probably benign Het
Itga1 A T 13: 115,035,284 L95* probably null Het
Klhl28 A G 12: 64,950,097 V490A probably damaging Het
Kntc1 A T 5: 123,760,643 N200I possibly damaging Het
L3mbtl4 A G 17: 68,459,799 K167R probably benign Het
Lgals1 A T 15: 78,929,730 T63S probably benign Het
Lnpep C A 17: 17,575,334 C305F probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mcmbp A G 7: 128,709,859 I310T possibly damaging Het
Mical2 G A 7: 112,346,789 R986H probably damaging Het
Muc5b A T 7: 141,861,593 S2759C possibly damaging Het
Myh7 A G 14: 54,991,927 V138A possibly damaging Het
Ncr1 T G 7: 4,341,301 probably null Het
Ndufa10 A T 1: 92,469,888 D145E possibly damaging Het
Neo1 T A 9: 58,894,024 probably null Het
Ninl A T 2: 150,949,781 S941T probably benign Het
Nrm T A 17: 35,861,519 probably null Het
Nup214 T C 2: 32,017,215 V1018A possibly damaging Het
Odf1 A G 15: 38,219,472 I15V probably benign Het
Olfr1023 C T 2: 85,886,994 H65Y probably damaging Het
Olfr118 T A 17: 37,672,168 N48K probably damaging Het
Olfr1406 C T 1: 173,183,891 R181H probably benign Het
Olfr32 T A 2: 90,138,660 T160S probably benign Het
Olfr376 A T 11: 73,374,884 N48I probably damaging Het
Olfr490 A T 7: 108,286,691 V145D probably benign Het
Olfr670 A T 7: 104,960,450 I94N probably damaging Het
Olfr850 C A 9: 19,478,086 D55Y probably benign Het
Osgin2 A T 4: 15,998,957 Y222N probably damaging Het
Pcdhga10 T C 18: 37,749,310 V708A probably benign Het
Pfn3 T C 13: 55,415,087 D27G possibly damaging Het
Plch2 A G 4: 155,010,865 probably null Het
Plin2 C A 4: 86,658,677 Q270H probably damaging Het
Polk A G 13: 96,493,895 F386S probably damaging Het
Prkar1a G A 11: 109,665,952 G286E probably damaging Het
Prodh A T 16: 18,080,185 L276Q probably damaging Het
Ranbp10 T C 8: 105,786,674 N202S probably damaging Het
Rapgef6 C A 11: 54,649,271 T724K probably benign Het
Rnf144a T A 12: 26,327,575 K56N probably benign Het
Rpa1 T A 11: 75,313,112 K303I probably damaging Het
Slc16a9 A C 10: 70,282,510 N220H possibly damaging Het
Slc28a3 T C 13: 58,576,850 I197V probably benign Het
Slc35d1 A T 4: 103,214,749 F19I Het
Sohlh2 A T 3: 55,192,300 E164D probably damaging Het
Sord A T 2: 122,263,284 K295* probably null Het
Spata31d1b A G 13: 59,712,382 Y23C probably benign Het
Stard9 T A 2: 120,679,936 Y333N probably damaging Het
Tas2r107 A G 6: 131,659,790 F99L probably damaging Het
Thap12 C T 7: 98,703,385 probably benign Het
Tmprss9 A T 10: 80,895,159 T840S probably benign Het
Trim16 T A 11: 62,829,200 probably null Het
Ttc16 C T 2: 32,774,793 probably null Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Unc80 A T 1: 66,612,212 Y1572F possibly damaging Het
Usp42 G T 5: 143,720,305 A320D possibly damaging Het
Vmn2r94 T C 17: 18,243,776 T751A probably damaging Het
Zbtb41 C T 1: 139,440,346 L591F probably damaging Het
Zdhhc5 T A 2: 84,694,318 E219D probably damaging Het
Zfp248 A T 6: 118,429,051 F526I probably damaging Het
Zfp322a T C 13: 23,356,388 K395E possibly damaging Het
Zfp423 G A 8: 87,780,249 P1156S probably benign Het
Zfp644 T C 5: 106,638,265 T139A possibly damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
Allure UTSW 17 27107303 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27112028 critical splice donor site probably null
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8263:Itpr3 UTSW 17 27115913 nonsense probably null
R8264:Itpr3 UTSW 17 27104112 synonymous silent
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27115919 missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27111926 missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27107303 missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27118677 unclassified probably benign
R8679:Itpr3 UTSW 17 27118677 unclassified probably benign
R8846:Itpr3 UTSW 17 27112022 missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27118677 unclassified probably benign
R8885:Itpr3 UTSW 17 27118677 unclassified probably benign
R8886:Itpr3 UTSW 17 27118677 unclassified probably benign
R8887:Itpr3 UTSW 17 27118677 unclassified probably benign
R8888:Itpr3 UTSW 17 27118677 unclassified probably benign
R8891:Itpr3 UTSW 17 27118677 unclassified probably benign
R8896:Itpr3 UTSW 17 27118677 unclassified probably benign
R8975:Itpr3 UTSW 17 27116654 missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27118677 unclassified probably benign
R9026:Itpr3 UTSW 17 27118677 unclassified probably benign
R9063:Itpr3 UTSW 17 27118677 unclassified probably benign
R9087:Itpr3 UTSW 17 27118677 unclassified probably benign
R9088:Itpr3 UTSW 17 27118677 unclassified probably benign
R9089:Itpr3 UTSW 17 27118677 unclassified probably benign
R9090:Itpr3 UTSW 17 27118677 unclassified probably benign
R9091:Itpr3 UTSW 17 27118677 unclassified probably benign
R9200:Itpr3 UTSW 17 27107662 missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27118677 unclassified probably benign
R9271:Itpr3 UTSW 17 27118677 unclassified probably benign
R9294:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27095925 missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27118677 unclassified probably benign
R9434:Itpr3 UTSW 17 27118677 unclassified probably benign
R9443:Itpr3 UTSW 17 27105549 missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27118677 unclassified probably benign
R9474:Itpr3 UTSW 17 27118677 unclassified probably benign
R9475:Itpr3 UTSW 17 27118677 unclassified probably benign
R9476:Itpr3 UTSW 17 27118677 unclassified probably benign
R9477:Itpr3 UTSW 17 27118677 unclassified probably benign
R9507:Itpr3 UTSW 17 27118677 unclassified probably benign
R9508:Itpr3 UTSW 17 27118677 unclassified probably benign
R9511:Itpr3 UTSW 17 27118677 unclassified probably benign
R9694:Itpr3 UTSW 17 27115953 missense probably damaging 0.99
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCTCAGATCCTAAGGCAGC -3'
(R):5'- CCAAGAGGCTGAGAAACATCTG -3'

Sequencing Primer
(F):5'- TCAGATCCTAAGGCAGCTGGAC -3'
(R):5'- CATCTGTATAATAAGCACAGGGC -3'
Posted On 2022-11-14