Incidental Mutation 'R9791:Myo3b'
ID 734587
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9791 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 70039126-70429198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70349943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1219 (H1219Q)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: H1219Q

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: H1219Q

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: H1191Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: H1191Q

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik T A 11: 97,775,768 I31F probably benign Het
Abcb1a T C 5: 8,698,604 Y312H probably damaging Het
Abcc10 A T 17: 46,322,259 I549N probably damaging Het
Agpat2 A G 2: 26,596,383 Y134H probably damaging Het
Alms1 A G 6: 85,619,443 D417G probably benign Het
Apol11b T A 15: 77,635,275 I202F probably benign Het
Arap1 C A 7: 101,388,169 Q468K probably benign Het
Arhgef4 T C 1: 34,793,364 probably null Het
Asap3 A T 4: 136,234,603 N285I probably damaging Het
Aspm A T 1: 139,480,637 I2421F probably damaging Het
Banp C A 8: 121,974,546 D17E probably benign Het
Bsx T G 9: 40,877,609 V154G probably damaging Het
Cacnb1 T C 11: 98,009,360 D324G probably damaging Het
Ccdc170 A T 10: 4,533,957 probably null Het
Ccdc187 T C 2: 26,281,215 H417R probably benign Het
Cct4 T A 11: 22,999,070 M272K probably damaging Het
Chd9 A G 8: 91,033,789 E2054G possibly damaging Het
Ctnnal1 A T 4: 56,844,584 S127T possibly damaging Het
Cttnbp2 T A 6: 18,376,028 H1504L probably benign Het
Cyp4a29 T A 4: 115,251,183 M368K probably damaging Het
Dhx32 A G 7: 133,724,538 F527L probably benign Het
Foxk1 T C 5: 142,401,984 V154A probably damaging Het
Frem3 G A 8: 80,613,261 E728K probably benign Het
Gemin5 G A 11: 58,130,020 Q1114* probably null Het
Gm11567 C T 11: 99,879,448 R71C unknown Het
Gm13272 T C 4: 88,780,205 V119A probably benign Het
Gpc6 T A 14: 116,926,023 C30S probably damaging Het
Gprc6a A C 10: 51,615,299 F785V probably damaging Het
Hormad1 T C 3: 95,587,382 V368A probably benign Het
Hsd17b4 G A 18: 50,191,840 probably null Het
Il17ra C T 6: 120,482,279 S797F probably damaging Het
Jmjd6 A G 11: 116,842,612 S80P probably benign Het
Klhdc2 T A 12: 69,300,221 N53K probably benign Het
Klhl30 C T 1: 91,354,367 P230L probably benign Het
March1 C A 8: 66,276,687 A46E probably benign Het
Mast4 T C 13: 102,754,197 T1050A probably benign Het
Mpp7 T C 18: 7,355,049 N459S probably benign Het
Mtfr1l A G 4: 134,530,752 V53A probably benign Het
Myh11 T A 16: 14,208,128 E1326V Het
Myh3 A G 11: 67,101,179 E1850G probably damaging Het
Myo16 A G 8: 10,569,925 D1492G unknown Het
Nphp4 A T 4: 152,562,148 Q1379L probably null Het
Olfr1500 A G 19: 13,827,550 I282T probably benign Het
Olfr948 C T 9: 39,319,519 V32I probably benign Het
Osbpl6 T G 2: 76,555,017 L265R probably damaging Het
Pld4 A G 12: 112,768,428 T440A probably damaging Het
Prr14 T C 7: 127,471,956 M1T probably null Het
Ptger4 A T 15: 5,243,697 M1K probably null Het
Ptpn22 A T 3: 103,888,526 T608S possibly damaging Het
S1pr2 A G 9: 20,968,023 W170R probably damaging Het
Specc1l A G 10: 75,230,769 I17M probably benign Het
Sptbn4 C G 7: 27,372,237 G1601R probably damaging Het
Sqor C T 2: 122,784,992 P11L probably benign Het
Stac2 T C 11: 98,043,623 D85G probably benign Het
Svs2 G A 2: 164,236,998 Q330* probably null Het
Taar7e A G 10: 24,037,656 I15V probably benign Het
Tcf4 A T 18: 69,636,936 Y275F probably damaging Het
Tenm4 A G 7: 96,888,839 N1873S probably damaging Het
Tert T A 13: 73,627,529 V133D probably benign Het
Tfap2a T A 13: 40,717,182 N410I probably damaging Het
Tjp3 A T 10: 81,273,860 D836E probably benign Het
Tox3 A T 8: 90,248,578 M475K unknown Het
Traf4 A T 11: 78,160,153 D392E probably damaging Het
Vav2 A G 2: 27,291,813 L338P probably damaging Het
Vmn1r81 T C 7: 12,260,186 N165S probably benign Het
Vmn2r9 A T 5: 108,847,543 V413E probably damaging Het
Wdr7 A T 18: 63,777,988 D817V probably damaging Het
Zbtb38 G A 9: 96,688,647 S128L probably damaging Het
Zfhx4 T A 3: 5,399,862 H1718Q probably damaging Het
Zfp945 G A 17: 22,852,254 H245Y probably benign Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
R8803:Myo3b UTSW 2 70252994 missense probably benign
R8843:Myo3b UTSW 2 70257981 missense probably damaging 1.00
R8896:Myo3b UTSW 2 70238816 missense probably damaging 1.00
R8904:Myo3b UTSW 2 70426908 missense probably benign 0.07
R8909:Myo3b UTSW 2 70253096 missense probably damaging 1.00
R9031:Myo3b UTSW 2 70251750 missense probably damaging 0.99
R9052:Myo3b UTSW 2 70232403 missense probably benign 0.00
R9251:Myo3b UTSW 2 70258081 nonsense probably null
R9268:Myo3b UTSW 2 70426961 makesense probably null
R9334:Myo3b UTSW 2 70217016 missense probably damaging 1.00
R9377:Myo3b UTSW 2 70238898 missense possibly damaging 0.78
R9457:Myo3b UTSW 2 70095209 missense probably benign 0.01
R9520:Myo3b UTSW 2 70232409 missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70245304 missense probably benign 0.43
R9671:Myo3b UTSW 2 70256564 missense probably damaging 1.00
R9790:Myo3b UTSW 2 70349943 missense probably benign 0.35
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGTACTGCAGCTTGGCTC -3'
(R):5'- GGCTTCCTGTTAACATTACATAGTC -3'

Sequencing Primer
(F):5'- TCAGTTCTATACAAGACCTAGGAAGC -3'
(R):5'- AGTCTCACTAATTGGATCCTGAC -3'
Posted On 2022-11-14