Incidental Mutation 'R9791:Svs5'
ID 734590
Institutional Source Beutler Lab
Gene Symbol Svs5
Ensembl Gene ENSMUSG00000017004
Gene Name seminal vesicle secretory protein 5
Synonyms seminal vesicle protein F, Svp-1, Svp1, SVS V, Svp5
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9791 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 164174685-164176314 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 164078918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 330 (Q330*)
Ref Sequence ENSEMBL: ENSMUSP00000042389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044953] [ENSMUST00000109374]
AlphaFold P30933
Predicted Effect probably null
Transcript: ENSMUST00000044953
AA Change: Q330*
SMART Domains Protein: ENSMUSP00000042389
Gene: ENSMUSG00000040132
AA Change: Q330*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:SVS_QK 110 121 1.2e-6 PFAM
Pfam:SVS_QK 122 137 3.9e-3 PFAM
Pfam:SVS_QK 139 149 1.3e-5 PFAM
Pfam:SVS_QK 151 166 8.4e-4 PFAM
Pfam:SVS_QK 168 179 5.3e-6 PFAM
Pfam:SVS_QK 180 195 3.9e-3 PFAM
Pfam:SVS_QK 197 207 1.3e-5 PFAM
Pfam:SVS_QK 210 221 8.8e-5 PFAM
Pfam:SVS_QK 225 236 7.7e-6 PFAM
Pfam:SVS_QK 238 249 6.1e-6 PFAM
Pfam:SVS_QK 249 260 5.2e-4 PFAM
Pfam:SVS_QK 262 272 3.1e-5 PFAM
Pfam:SVS_QK 323 334 6.7e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109374
AA Change: Q330*
SMART Domains Protein: ENSMUSP00000104999
Gene: ENSMUSG00000040132
AA Change: Q330*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:SVS_QK 110 121 1.2e-6 PFAM
Pfam:SVS_QK 122 137 3.9e-3 PFAM
Pfam:SVS_QK 139 149 1.3e-5 PFAM
Pfam:SVS_QK 151 166 8.4e-4 PFAM
Pfam:SVS_QK 168 179 5.3e-6 PFAM
Pfam:SVS_QK 180 195 3.9e-3 PFAM
Pfam:SVS_QK 197 207 1.3e-5 PFAM
Pfam:SVS_QK 210 221 8.8e-5 PFAM
Pfam:SVS_QK 225 236 7.7e-6 PFAM
Pfam:SVS_QK 238 249 6.1e-6 PFAM
Pfam:SVS_QK 249 260 5.2e-4 PFAM
Pfam:SVS_QK 262 272 3.1e-5 PFAM
Pfam:SVS_QK 323 334 6.7e-5 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,748,604 (GRCm39) Y312H probably damaging Het
Abcc10 A T 17: 46,633,185 (GRCm39) I549N probably damaging Het
Agpat2 A G 2: 26,486,395 (GRCm39) Y134H probably damaging Het
Alms1 A G 6: 85,596,425 (GRCm39) D417G probably benign Het
Apol11b T A 15: 77,519,475 (GRCm39) I202F probably benign Het
Arap1 C A 7: 101,037,376 (GRCm39) Q468K probably benign Het
Arhgef4 T C 1: 34,832,445 (GRCm39) probably null Het
Asap3 A T 4: 135,961,914 (GRCm39) N285I probably damaging Het
Aspm A T 1: 139,408,375 (GRCm39) I2421F probably damaging Het
Banp C A 8: 122,701,285 (GRCm39) D17E probably benign Het
Bsx T G 9: 40,788,905 (GRCm39) V154G probably damaging Het
Cacnb1 T C 11: 97,900,186 (GRCm39) D324G probably damaging Het
Ccdc170 A T 10: 4,483,957 (GRCm39) probably null Het
Ccdc187 T C 2: 26,171,227 (GRCm39) H417R probably benign Het
Cct4 T A 11: 22,949,070 (GRCm39) M272K probably damaging Het
Chd9 A G 8: 91,760,417 (GRCm39) E2054G possibly damaging Het
Ctnnal1 A T 4: 56,844,584 (GRCm39) S127T possibly damaging Het
Cttnbp2 T A 6: 18,376,027 (GRCm39) H1504L probably benign Het
Cyp4a29 T A 4: 115,108,380 (GRCm39) M368K probably damaging Het
Dhx32 A G 7: 133,326,267 (GRCm39) F527L probably benign Het
Foxk1 T C 5: 142,387,739 (GRCm39) V154A probably damaging Het
Frem3 G A 8: 81,339,890 (GRCm39) E728K probably benign Het
Gemin5 G A 11: 58,020,846 (GRCm39) Q1114* probably null Het
Gm11567 C T 11: 99,770,274 (GRCm39) R71C unknown Het
Gm13272 T C 4: 88,698,442 (GRCm39) V119A probably benign Het
Gpc6 T A 14: 117,163,435 (GRCm39) C30S probably damaging Het
Gprc6a A C 10: 51,491,395 (GRCm39) F785V probably damaging Het
Hormad1 T C 3: 95,494,693 (GRCm39) V368A probably benign Het
Hsd17b4 G A 18: 50,324,907 (GRCm39) probably null Het
Il17ra C T 6: 120,459,240 (GRCm39) S797F probably damaging Het
Jmjd6 A G 11: 116,733,438 (GRCm39) S80P probably benign Het
Klhdc2 T A 12: 69,346,995 (GRCm39) N53K probably benign Het
Klhl30 C T 1: 91,282,089 (GRCm39) P230L probably benign Het
Marchf1 C A 8: 66,729,339 (GRCm39) A46E probably benign Het
Mast4 T C 13: 102,890,705 (GRCm39) T1050A probably benign Het
Mpp7 T C 18: 7,355,049 (GRCm39) N459S probably benign Het
Mtfr1l A G 4: 134,258,063 (GRCm39) V53A probably benign Het
Myh11 T A 16: 14,025,992 (GRCm39) E1326V Het
Myh3 A G 11: 66,992,005 (GRCm39) E1850G probably damaging Het
Myo16 A G 8: 10,619,925 (GRCm39) D1492G unknown Het
Myo3b C A 2: 70,180,287 (GRCm39) H1219Q probably benign Het
Nphp4 A T 4: 152,646,605 (GRCm39) Q1379L probably null Het
Or8g30 C T 9: 39,230,815 (GRCm39) V32I probably benign Het
Or9q1 A G 19: 13,804,914 (GRCm39) I282T probably benign Het
Osbpl6 T G 2: 76,385,361 (GRCm39) L265R probably damaging Het
Pld4 A G 12: 112,734,862 (GRCm39) T440A probably damaging Het
Prr14 T C 7: 127,071,128 (GRCm39) M1T probably null Het
Ptger4 A T 15: 5,273,178 (GRCm39) M1K probably null Het
Ptpn22 A T 3: 103,795,842 (GRCm39) T608S possibly damaging Het
S1pr2 A G 9: 20,879,319 (GRCm39) W170R probably damaging Het
Specc1l A G 10: 75,066,603 (GRCm39) I17M probably benign Het
Spmap1 T A 11: 97,666,594 (GRCm39) I31F probably benign Het
Sptbn4 C G 7: 27,071,662 (GRCm39) G1601R probably damaging Het
Sqor C T 2: 122,626,912 (GRCm39) P11L probably benign Het
Stac2 T C 11: 97,934,449 (GRCm39) D85G probably benign Het
Taar7e A G 10: 23,913,554 (GRCm39) I15V probably benign Het
Tcf4 A T 18: 69,770,007 (GRCm39) Y275F probably damaging Het
Tenm4 A G 7: 96,538,046 (GRCm39) N1873S probably damaging Het
Tert T A 13: 73,775,648 (GRCm39) V133D probably benign Het
Tfap2a T A 13: 40,870,658 (GRCm39) N410I probably damaging Het
Tjp3 A T 10: 81,109,694 (GRCm39) D836E probably benign Het
Tox3 A T 8: 90,975,206 (GRCm39) M475K unknown Het
Traf4 A T 11: 78,050,979 (GRCm39) D392E probably damaging Het
Vav2 A G 2: 27,181,825 (GRCm39) L338P probably damaging Het
Vmn1r81 T C 7: 11,994,113 (GRCm39) N165S probably benign Het
Vmn2r9 A T 5: 108,995,409 (GRCm39) V413E probably damaging Het
Wdr7 A T 18: 63,911,059 (GRCm39) D817V probably damaging Het
Zbtb38 G A 9: 96,570,700 (GRCm39) S128L probably damaging Het
Zfhx4 T A 3: 5,464,922 (GRCm39) H1718Q probably damaging Het
Zfp945 G A 17: 23,071,228 (GRCm39) H245Y probably benign Het
Other mutations in Svs5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Svs5 APN 2 164,078,962 (GRCm39) missense possibly damaging 0.86
IGL01722:Svs5 APN 2 164,079,446 (GRCm39) missense possibly damaging 0.71
IGL03189:Svs5 APN 2 164,079,032 (GRCm39) missense possibly damaging 0.73
IGL03378:Svs5 APN 2 164,175,260 (GRCm39) missense probably benign 0.00
R0781:Svs5 UTSW 2 164,175,507 (GRCm39) missense probably benign 0.16
R1110:Svs5 UTSW 2 164,175,507 (GRCm39) missense probably benign 0.16
R1276:Svs5 UTSW 2 164,079,168 (GRCm39) missense possibly damaging 0.95
R1541:Svs5 UTSW 2 164,078,929 (GRCm39) missense possibly damaging 0.71
R1590:Svs5 UTSW 2 164,079,578 (GRCm39) missense possibly damaging 0.86
R3103:Svs5 UTSW 2 164,175,313 (GRCm39) missense probably benign 0.00
R3946:Svs5 UTSW 2 164,079,047 (GRCm39) missense probably benign 0.01
R3965:Svs5 UTSW 2 164,079,662 (GRCm39) missense possibly damaging 0.53
R4075:Svs5 UTSW 2 164,079,238 (GRCm39) missense probably benign 0.01
R4632:Svs5 UTSW 2 164,079,667 (GRCm39) missense probably benign 0.40
R4732:Svs5 UTSW 2 164,079,043 (GRCm39) missense possibly damaging 0.87
R4733:Svs5 UTSW 2 164,079,043 (GRCm39) missense possibly damaging 0.87
R4839:Svs5 UTSW 2 164,078,806 (GRCm39) missense probably benign 0.40
R5706:Svs5 UTSW 2 164,079,589 (GRCm39) missense possibly damaging 0.53
R6936:Svs5 UTSW 2 164,079,548 (GRCm39) missense possibly damaging 0.86
R7052:Svs5 UTSW 2 164,080,126 (GRCm39) missense unknown
R7338:Svs5 UTSW 2 164,174,728 (GRCm39) missense possibly damaging 0.96
R7836:Svs5 UTSW 2 164,079,500 (GRCm39) missense possibly damaging 0.86
R8017:Svs5 UTSW 2 164,175,341 (GRCm39) missense possibly damaging 0.86
R8019:Svs5 UTSW 2 164,175,341 (GRCm39) missense possibly damaging 0.86
R8035:Svs5 UTSW 2 164,079,053 (GRCm39) missense probably benign 0.18
R8100:Svs5 UTSW 2 164,079,712 (GRCm39) missense probably benign 0.08
R8187:Svs5 UTSW 2 164,079,692 (GRCm39) missense possibly damaging 0.88
R8310:Svs5 UTSW 2 164,080,091 (GRCm39) missense probably damaging 1.00
R8312:Svs5 UTSW 2 164,080,091 (GRCm39) missense probably damaging 1.00
R9089:Svs5 UTSW 2 164,079,341 (GRCm39) missense probably benign 0.27
R9156:Svs5 UTSW 2 164,079,509 (GRCm39) missense probably benign 0.32
R9545:Svs5 UTSW 2 164,079,313 (GRCm39) missense possibly damaging 0.52
R9790:Svs5 UTSW 2 164,078,918 (GRCm39) nonsense probably null
Z1176:Svs5 UTSW 2 164,174,711 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GGACCCAGGACTTCTTCATATAC -3'
(R):5'- TCCCAACTAAAGTCCTATGGCC -3'

Sequencing Primer
(F):5'- TCCTACTTGGTAGAAACATACCTTG -3'
(R):5'- ACAAAAATCCCTCAAAGGTTTTTCTC -3'
Posted On 2022-11-14