Mutagenetix > Incidental Mutation

Incidental Mutation 'R9791:Zbtb38'

734621

Institutional Source

Beutler Lab

Gene Symbol

Zbtb38

Ensembl Gene

ENSMUSG00000040433

Gene Name

zinc finger and BTB domain containing 38

Synonyms

CIBZ, A930014K01Rik, Zenon homolog

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.620) question?

Stock #

R9791 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

96682770-96752831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 96688647 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 128 (S128L)

Ref Sequence

ENSEMBL: ENSMUSP00000120040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]

AlphaFold

Q3LR78

Predicted Effect

probably damaging
Transcript: ENSMUST00000093798
AA Change: S128L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: S128L

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	935	N/A	INTRINSIC
low complexity region	994	1002	N/A	INTRINSIC
ZnF_C2H2	1013	1035	3.63e-3	SMART
ZnF_C2H2	1041	1063	9.73e-4	SMART
ZnF_C2H2	1069	1091	1.45e-2	SMART
ZnF_C2H2	1097	1119	1.02e1	SMART
ZnF_C2H2	1128	1150	1.67e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000126066
AA Change: S128L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433
AA Change: S128L

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	926	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000128269
AA Change: S128L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433
AA Change: S128L

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140121
AA Change: S128L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433
AA Change: S128L

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000152594
AA Change: S128L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: S128L

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	935	N/A	INTRINSIC
low complexity region	994	1002	N/A	INTRINSIC
ZnF_C2H2	1013	1035	3.63e-3	SMART
ZnF_C2H2	1041	1063	9.73e-4	SMART
ZnF_C2H2	1069	1091	1.45e-2	SMART
ZnF_C2H2	1097	1119	1.02e1	SMART
ZnF_C2H2	1128	1150	1.67e-2	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001P01Rik	T	A	11: 97,775,768	I31F	probably benign	Het
Abcb1a	T	C	5: 8,698,604	Y312H	probably damaging	Het
Abcc10	A	T	17: 46,322,259	I549N	probably damaging	Het
Agpat2	A	G	2: 26,596,383	Y134H	probably damaging	Het
Alms1	A	G	6: 85,619,443	D417G	probably benign	Het
Apol11b	T	A	15: 77,635,275	I202F	probably benign	Het
Arap1	C	A	7: 101,388,169	Q468K	probably benign	Het
Arhgef4	T	C	1: 34,793,364		probably null	Het
Asap3	A	T	4: 136,234,603	N285I	probably damaging	Het
Aspm	A	T	1: 139,480,637	I2421F	probably damaging	Het
Banp	C	A	8: 121,974,546	D17E	probably benign	Het
Bsx	T	G	9: 40,877,609	V154G	probably damaging	Het
Cacnb1	T	C	11: 98,009,360	D324G	probably damaging	Het
Ccdc170	A	T	10: 4,533,957		probably null	Het
Ccdc187	T	C	2: 26,281,215	H417R	probably benign	Het
Cct4	T	A	11: 22,999,070	M272K	probably damaging	Het
Chd9	A	G	8: 91,033,789	E2054G	possibly damaging	Het
Ctnnal1	A	T	4: 56,844,584	S127T	possibly damaging	Het
Cttnbp2	T	A	6: 18,376,028	H1504L	probably benign	Het
Cyp4a29	T	A	4: 115,251,183	M368K	probably damaging	Het
Dhx32	A	G	7: 133,724,538	F527L	probably benign	Het
Foxk1	T	C	5: 142,401,984	V154A	probably damaging	Het
Frem3	G	A	8: 80,613,261	E728K	probably benign	Het
Gemin5	G	A	11: 58,130,020	Q1114*	probably null	Het
Gm11567	C	T	11: 99,879,448	R71C	unknown	Het
Gm13272	T	C	4: 88,780,205	V119A	probably benign	Het
Gpc6	T	A	14: 116,926,023	C30S	probably damaging	Het
Gprc6a	A	C	10: 51,615,299	F785V	probably damaging	Het
Hormad1	T	C	3: 95,587,382	V368A	probably benign	Het
Hsd17b4	G	A	18: 50,191,840		probably null	Het
Il17ra	C	T	6: 120,482,279	S797F	probably damaging	Het
Jmjd6	A	G	11: 116,842,612	S80P	probably benign	Het
Klhdc2	T	A	12: 69,300,221	N53K	probably benign	Het
Klhl30	C	T	1: 91,354,367	P230L	probably benign	Het
March1	C	A	8: 66,276,687	A46E	probably benign	Het
Mast4	T	C	13: 102,754,197	T1050A	probably benign	Het
Mpp7	T	C	18: 7,355,049	N459S	probably benign	Het
Mtfr1l	A	G	4: 134,530,752	V53A	probably benign	Het
Myh11	T	A	16: 14,208,128	E1326V		Het
Myh3	A	G	11: 67,101,179	E1850G	probably damaging	Het
Myo16	A	G	8: 10,569,925	D1492G	unknown	Het
Myo3b	C	A	2: 70,349,943	H1219Q	probably benign	Het
Nphp4	A	T	4: 152,562,148	Q1379L	probably null	Het
Olfr1500	A	G	19: 13,827,550	I282T	probably benign	Het
Olfr948	C	T	9: 39,319,519	V32I	probably benign	Het
Osbpl6	T	G	2: 76,555,017	L265R	probably damaging	Het
Pld4	A	G	12: 112,768,428	T440A	probably damaging	Het
Prr14	T	C	7: 127,471,956	M1T	probably null	Het
Ptger4	A	T	15: 5,243,697	M1K	probably null	Het
Ptpn22	A	T	3: 103,888,526	T608S	possibly damaging	Het
S1pr2	A	G	9: 20,968,023	W170R	probably damaging	Het
Specc1l	A	G	10: 75,230,769	I17M	probably benign	Het
Sptbn4	C	G	7: 27,372,237	G1601R	probably damaging	Het
Sqor	C	T	2: 122,784,992	P11L	probably benign	Het
Stac2	T	C	11: 98,043,623	D85G	probably benign	Het
Svs2	G	A	2: 164,236,998	Q330*	probably null	Het
Taar7e	A	G	10: 24,037,656	I15V	probably benign	Het
Tcf4	A	T	18: 69,636,936	Y275F	probably damaging	Het
Tenm4	A	G	7: 96,888,839	N1873S	probably damaging	Het
Tert	T	A	13: 73,627,529	V133D	probably benign	Het
Tfap2a	T	A	13: 40,717,182	N410I	probably damaging	Het
Tjp3	A	T	10: 81,273,860	D836E	probably benign	Het
Tox3	A	T	8: 90,248,578	M475K	unknown	Het
Traf4	A	T	11: 78,160,153	D392E	probably damaging	Het
Vav2	A	G	2: 27,291,813	L338P	probably damaging	Het
Vmn1r81	T	C	7: 12,260,186	N165S	probably benign	Het
Vmn2r9	A	T	5: 108,847,543	V413E	probably damaging	Het
Wdr7	A	T	18: 63,777,988	D817V	probably damaging	Het
Zfhx4	T	A	3: 5,399,862	H1718Q	probably damaging	Het
Zfp945	G	A	17: 22,852,254	H245Y	probably benign	Het

Other mutations in Zbtb38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Zbtb38	APN	9	96687494	missense	probably damaging	1.00
IGL01895:Zbtb38	APN	9	96688408	missense	probably benign	0.00
IGL02513:Zbtb38	APN	9	96687073	missense	probably damaging	1.00
IGL02649:Zbtb38	APN	9	96686619	missense	probably damaging	0.96
IGL02938:Zbtb38	APN	9	96687174	missense	probably benign	0.11
PIT4131001:Zbtb38	UTSW	9	96686316	missense	probably damaging	1.00
R0048:Zbtb38	UTSW	9	96687676	missense	probably damaging	1.00
R0152:Zbtb38	UTSW	9	96686280	missense	probably damaging	1.00
R0158:Zbtb38	UTSW	9	96686940	missense	possibly damaging	0.46
R0519:Zbtb38	UTSW	9	96685773	missense	probably damaging	1.00
R0594:Zbtb38	UTSW	9	96685954	missense	probably damaging	1.00
R1556:Zbtb38	UTSW	9	96686991	missense	probably benign	0.26
R1698:Zbtb38	UTSW	9	96685462	missense	probably benign
R1772:Zbtb38	UTSW	9	96688041	missense	probably damaging	1.00
R1799:Zbtb38	UTSW	9	96688881	missense	probably damaging	1.00
R1837:Zbtb38	UTSW	9	96686995	missense	probably benign
R2446:Zbtb38	UTSW	9	96687646	missense	probably damaging	1.00
R3153:Zbtb38	UTSW	9	96688249	missense	probably benign	0.34
R3950:Zbtb38	UTSW	9	96687546	missense	probably damaging	1.00
R4240:Zbtb38	UTSW	9	96686102	small deletion	probably benign
R4630:Zbtb38	UTSW	9	96688851	missense	probably damaging	1.00
R4666:Zbtb38	UTSW	9	96688383	missense	probably damaging	1.00
R4732:Zbtb38	UTSW	9	96687684	missense	probably damaging	1.00
R4733:Zbtb38	UTSW	9	96687684	missense	probably damaging	1.00
R4824:Zbtb38	UTSW	9	96688201	missense	probably benign	0.06
R5006:Zbtb38	UTSW	9	96685651	missense	probably damaging	1.00
R5109:Zbtb38	UTSW	9	96687009	missense	probably damaging	0.99
R5251:Zbtb38	UTSW	9	96687108	missense	probably benign	0.43
R5396:Zbtb38	UTSW	9	96687643	missense	probably damaging	1.00
R5659:Zbtb38	UTSW	9	96687420	missense	probably damaging	1.00
R6249:Zbtb38	UTSW	9	96685992	missense	probably damaging	0.99
R6294:Zbtb38	UTSW	9	96687229	missense	probably benign	0.05
R6615:Zbtb38	UTSW	9	96686654	nonsense	probably null
R6625:Zbtb38	UTSW	9	96687313	missense	probably damaging	1.00
R6885:Zbtb38	UTSW	9	96686464	missense	probably damaging	1.00
R7304:Zbtb38	UTSW	9	96687427	missense	probably damaging	0.96
R7675:Zbtb38	UTSW	9	96685541	missense	probably benign	0.00
R7823:Zbtb38	UTSW	9	96685976	nonsense	probably null
R7900:Zbtb38	UTSW	9	96688936	missense	probably damaging	1.00
R8077:Zbtb38	UTSW	9	96688100	missense	probably benign
R8432:Zbtb38	UTSW	9	96686238	missense	possibly damaging	0.68
R8802:Zbtb38	UTSW	9	96685570	missense	probably benign	0.13
R8930:Zbtb38	UTSW	9	96686381	missense	probably benign	0.04
R8932:Zbtb38	UTSW	9	96686381	missense	probably benign	0.04
R9008:Zbtb38	UTSW	9	96687047	missense	probably benign
R9347:Zbtb38	UTSW	9	96685596	missense	probably damaging	0.99
R9520:Zbtb38	UTSW	9	96686051	missense	probably damaging	0.99
R9568:Zbtb38	UTSW	9	96688891	missense	probably damaging	1.00
R9680:Zbtb38	UTSW	9	96688344	missense	probably benign	0.03
R9777:Zbtb38	UTSW	9	96688302	missense	possibly damaging	0.49
R9777:Zbtb38	UTSW	9	96688303	missense	probably damaging	0.96
R9790:Zbtb38	UTSW	9	96688647	missense	probably damaging	1.00
X0066:Zbtb38	UTSW	9	96687612	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTGTCCTCATGGAATCAGAC -3'
(R):5'- GATCTGCATTTCCAGTCACGTC -3'

Sequencing Primer
(F):5'- GGAATCAGACACCTTTTTGAAGC -3'
(R):5'- GCATTTCCAGTCACGTCTTGGAG -3'

Posted On

2022-11-14