Incidental Mutation 'R9791:Gprc6a'
ID 734624
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9791 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51614823-51631461 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 51615299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 785 (F785V)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably damaging
Transcript: ENSMUST00000020062
AA Change: F785V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: F785V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218684
AA Change: F610V

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000219286
AA Change: F714V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik T A 11: 97,775,768 I31F probably benign Het
Abcb1a T C 5: 8,698,604 Y312H probably damaging Het
Abcc10 A T 17: 46,322,259 I549N probably damaging Het
Agpat2 A G 2: 26,596,383 Y134H probably damaging Het
Alms1 A G 6: 85,619,443 D417G probably benign Het
Apol11b T A 15: 77,635,275 I202F probably benign Het
Arap1 C A 7: 101,388,169 Q468K probably benign Het
Arhgef4 T C 1: 34,793,364 probably null Het
Asap3 A T 4: 136,234,603 N285I probably damaging Het
Aspm A T 1: 139,480,637 I2421F probably damaging Het
Banp C A 8: 121,974,546 D17E probably benign Het
Bsx T G 9: 40,877,609 V154G probably damaging Het
Cacnb1 T C 11: 98,009,360 D324G probably damaging Het
Ccdc170 A T 10: 4,533,957 probably null Het
Ccdc187 T C 2: 26,281,215 H417R probably benign Het
Cct4 T A 11: 22,999,070 M272K probably damaging Het
Chd9 A G 8: 91,033,789 E2054G possibly damaging Het
Ctnnal1 A T 4: 56,844,584 S127T possibly damaging Het
Cttnbp2 T A 6: 18,376,028 H1504L probably benign Het
Cyp4a29 T A 4: 115,251,183 M368K probably damaging Het
Dhx32 A G 7: 133,724,538 F527L probably benign Het
Foxk1 T C 5: 142,401,984 V154A probably damaging Het
Frem3 G A 8: 80,613,261 E728K probably benign Het
Gemin5 G A 11: 58,130,020 Q1114* probably null Het
Gm11567 C T 11: 99,879,448 R71C unknown Het
Gm13272 T C 4: 88,780,205 V119A probably benign Het
Gpc6 T A 14: 116,926,023 C30S probably damaging Het
Hormad1 T C 3: 95,587,382 V368A probably benign Het
Hsd17b4 G A 18: 50,191,840 probably null Het
Il17ra C T 6: 120,482,279 S797F probably damaging Het
Jmjd6 A G 11: 116,842,612 S80P probably benign Het
Klhdc2 T A 12: 69,300,221 N53K probably benign Het
Klhl30 C T 1: 91,354,367 P230L probably benign Het
March1 C A 8: 66,276,687 A46E probably benign Het
Mast4 T C 13: 102,754,197 T1050A probably benign Het
Mpp7 T C 18: 7,355,049 N459S probably benign Het
Mtfr1l A G 4: 134,530,752 V53A probably benign Het
Myh11 T A 16: 14,208,128 E1326V Het
Myh3 A G 11: 67,101,179 E1850G probably damaging Het
Myo16 A G 8: 10,569,925 D1492G unknown Het
Myo3b C A 2: 70,349,943 H1219Q probably benign Het
Nphp4 A T 4: 152,562,148 Q1379L probably null Het
Olfr1500 A G 19: 13,827,550 I282T probably benign Het
Olfr948 C T 9: 39,319,519 V32I probably benign Het
Osbpl6 T G 2: 76,555,017 L265R probably damaging Het
Pld4 A G 12: 112,768,428 T440A probably damaging Het
Prr14 T C 7: 127,471,956 M1T probably null Het
Ptger4 A T 15: 5,243,697 M1K probably null Het
Ptpn22 A T 3: 103,888,526 T608S possibly damaging Het
S1pr2 A G 9: 20,968,023 W170R probably damaging Het
Specc1l A G 10: 75,230,769 I17M probably benign Het
Sptbn4 C G 7: 27,372,237 G1601R probably damaging Het
Sqor C T 2: 122,784,992 P11L probably benign Het
Stac2 T C 11: 98,043,623 D85G probably benign Het
Svs2 G A 2: 164,236,998 Q330* probably null Het
Taar7e A G 10: 24,037,656 I15V probably benign Het
Tcf4 A T 18: 69,636,936 Y275F probably damaging Het
Tenm4 A G 7: 96,888,839 N1873S probably damaging Het
Tert T A 13: 73,627,529 V133D probably benign Het
Tfap2a T A 13: 40,717,182 N410I probably damaging Het
Tjp3 A T 10: 81,273,860 D836E probably benign Het
Tox3 A T 8: 90,248,578 M475K unknown Het
Traf4 A T 11: 78,160,153 D392E probably damaging Het
Vav2 A G 2: 27,291,813 L338P probably damaging Het
Vmn1r81 T C 7: 12,260,186 N165S probably benign Het
Vmn2r9 A T 5: 108,847,543 V413E probably damaging Het
Wdr7 A T 18: 63,777,988 D817V probably damaging Het
Zbtb38 G A 9: 96,688,647 S128L probably damaging Het
Zfhx4 T A 3: 5,399,862 H1718Q probably damaging Het
Zfp945 G A 17: 22,852,254 H245Y probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
R8829:Gprc6a UTSW 10 51615199 missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51621086 missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51615410 missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51628268 missense probably benign 0.20
R9766:Gprc6a UTSW 10 51615788 missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCTGGAGGAAGGCTGATTTG -3'
(R):5'- CATTTGCACTCTTTGGCTGG -3'

Sequencing Primer
(F):5'- GTCTTCTGCTTGCAAAGAATAATG -3'
(R):5'- GCTGGCAGCACCTAGTG -3'
Posted On 2022-11-14