Incidental Mutation 'R9793:Cntln'
ID 734741
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms B430108F07Rik, D530005L17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R9793 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 84884309-85131921 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85067561 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 951 (L951F)
Ref Sequence ENSEMBL: ENSMUSP00000044138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably benign
Transcript: ENSMUST00000047023
AA Change: L951F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: L951F

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
AA Change: L950F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: L950F

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,303 S517G unknown Het
Add2 A T 6: 86,101,153 probably null Het
Afap1l1 T C 18: 61,741,751 D453G possibly damaging Het
Agrn A G 4: 156,176,672 V656A probably benign Het
Aldh3a1 T C 11: 61,218,101 Y443H probably damaging Het
Alpk3 T C 7: 81,101,133 probably null Het
Ano1 A T 7: 144,621,697 W495R probably damaging Het
Apc T A 18: 34,314,575 L1508Q probably damaging Het
Cald1 A T 6: 34,746,136 M52L Het
Cdk11b T A 4: 155,647,921 H510Q unknown Het
Cdk12 T A 11: 98,211,225 D636E unknown Het
Cfap53 A G 18: 74,305,670 D306G probably benign Het
Cntnap4 T C 8: 112,881,725 V1259A probably benign Het
Cntnap5c A T 17: 58,102,197 T477S probably benign Het
Cyp4a30b A G 4: 115,458,970 T298A probably benign Het
Dopey2 T A 16: 93,801,615 D2006E probably benign Het
Ermard T C 17: 15,061,179 L617P probably damaging Het
Glipr1l2 A G 10: 112,107,000 I253M probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grik3 A G 4: 125,632,522 T183A probably damaging Het
Hao1 T A 2: 134,530,632 Y152F possibly damaging Het
Hdac7 T C 15: 97,800,790 T629A possibly damaging Het
Hmcn1 G A 1: 150,732,938 P1498S possibly damaging Het
Iqcf3 T A 9: 106,557,515 K41N probably benign Het
Kif26a C T 12: 112,176,453 A1047V probably damaging Het
Lrriq3 T C 3: 155,187,676 M338T probably benign Het
Map1a T C 2: 121,290,823 probably null Het
Ncoa2 G T 1: 13,190,131 Q107K possibly damaging Het
Nsd2 A G 5: 33,846,145 D213G possibly damaging Het
Nuggc T C 14: 65,609,896 S131P probably damaging Het
Nwd2 A G 5: 63,806,889 E1272G probably damaging Het
Olfr1099 T A 2: 86,958,775 I228F probably damaging Het
Olfr1251 T C 2: 89,667,467 I140V probably benign Het
Olfr1315-ps1 T C 2: 112,110,985 H89R probably benign Het
Olfr1385 A T 11: 49,495,055 N174I probably damaging Het
Olfr1467 A T 19: 13,365,150 H174L probably damaging Het
Olfr554 G A 7: 102,640,581 V112I probably benign Het
Otud7a C T 7: 63,729,097 R232W probably damaging Het
Pacsin3 C A 2: 91,263,815 A363D probably benign Het
Pcdh17 C T 14: 84,532,910 R943* probably null Het
Pkd1 A G 17: 24,581,198 T2978A probably benign Het
Pkhd1l1 T C 15: 44,543,587 S2407P probably benign Het
Ppip5k2 A T 1: 97,744,097 Y489* probably null Het
Rasgrp1 T C 2: 117,287,948 D520G probably benign Het
Rbm20 C A 19: 53,864,120 T1177K probably benign Het
Rex2 A C 4: 147,057,582 N176H probably damaging Het
Rsl1d1 T C 16: 11,199,436 N194S possibly damaging Het
Sel1l3 C A 5: 53,172,582 R477L probably benign Het
Sidt2 A G 9: 45,939,265 Y851H probably damaging Het
Sirpb1b G A 3: 15,575,014 probably benign Het
Slc6a7 C A 18: 61,005,794 R214L probably benign Het
Srrt G C 5: 137,296,573 I739M probably benign Het
Tbc1d22a T C 15: 86,235,638 L81P probably damaging Het
Trim42 A G 9: 97,363,376 I457T probably damaging Het
Ttc23l T A 15: 10,537,645 I180F probably benign Het
Usp9y T C Y: 1,364,679 M1045V probably benign Het
Vim A G 2: 13,574,787 D119G probably benign Het
Vmn2r118 T C 17: 55,592,496 T803A probably damaging Het
Vwa3a C A 7: 120,784,084 A636D probably damaging Het
Wdr26 A G 1: 181,209,247 F143S probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
R7670:Cntln UTSW 4 84979340 missense possibly damaging 0.66
R7707:Cntln UTSW 4 84884616 missense probably damaging 1.00
R7895:Cntln UTSW 4 85063324 missense possibly damaging 0.91
R8176:Cntln UTSW 4 84888689 missense probably damaging 0.99
R8247:Cntln UTSW 4 85100780 missense probably benign 0.39
R8264:Cntln UTSW 4 85098411 missense probably damaging 1.00
R8293:Cntln UTSW 4 85033838 missense probably damaging 1.00
R8536:Cntln UTSW 4 84957049 missense probably damaging 1.00
R8844:Cntln UTSW 4 84973997 missense probably damaging 1.00
R8924:Cntln UTSW 4 84888699 missense probably damaging 1.00
R8955:Cntln UTSW 4 85067873 missense possibly damaging 0.85
R8960:Cntln UTSW 4 85100724 missense possibly damaging 0.59
R8979:Cntln UTSW 4 85130673 missense probably damaging 1.00
R9255:Cntln UTSW 4 85100866 missense possibly damaging 0.93
R9314:Cntln UTSW 4 85006482 missense probably damaging 1.00
R9353:Cntln UTSW 4 84884360 unclassified probably benign
R9361:Cntln UTSW 4 85049914 missense probably benign 0.23
R9376:Cntln UTSW 4 84957021 missense probably benign 0.24
R9382:Cntln UTSW 4 85050081 missense probably benign 0.13
R9471:Cntln UTSW 4 85049782 missense possibly damaging 0.62
R9478:Cntln UTSW 4 84979393 missense probably benign 0.00
R9527:Cntln UTSW 4 84973883 missense probably damaging 1.00
R9788:Cntln UTSW 4 85049856 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGGTTTTCAATTGAGGAACC -3'
(R):5'- TCTGTTGCTGCAAGGATACG -3'

Sequencing Primer
(F):5'- GAGGTTTTCAATTGAGGAACCATTTC -3'
(R):5'- CGATCCGTTCTCGTAATGAAATGG -3'
Posted On 2022-11-14