Incidental Mutation 'R9794:5830411N06Rik'
ID 734818
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9794 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 140294803 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 398 (G398D)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect probably damaging
Transcript: ENSMUST00000093984
AA Change: G282D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: G282D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164583
AA Change: G398D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: G398D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,741 Y428* probably null Het
9930012K11Rik T A 14: 70,157,589 I39L possibly damaging Het
Acacb T C 5: 114,249,517 V2415A probably benign Het
Adgrg6 C A 10: 14,438,452 G669C probably damaging Het
Arhgdib A G 6: 136,929,610 probably null Het
Arhgef18 G A 8: 3,451,634 V643I probably benign Het
Arntl2 T A 6: 146,832,535 D543E probably benign Het
Aspm T A 1: 139,478,742 I1789N probably damaging Het
Atm C T 9: 53,518,567 V390I probably benign Het
AW554918 A G 18: 25,203,974 E148G probably damaging Het
Camk2a T C 18: 60,963,959 V327A probably benign Het
Celsr3 T C 9: 108,851,303 V3302A probably benign Het
Ces2a G A 8: 104,741,264 V509M probably benign Het
Cpa5 T C 6: 30,625,921 probably null Het
Cplx3 A T 9: 57,602,239 *159R probably null Het
Cyp2b23 A T 7: 26,681,696 Y79N probably benign Het
Dapk1 A G 13: 60,761,268 T1232A probably damaging Het
Dsg3 A T 18: 20,540,097 T942S probably benign Het
Efnb3 G A 11: 69,557,406 P70L probably damaging Het
Elmsan1 T A 12: 84,173,802 Q126L probably damaging Het
Eln G T 5: 134,722,498 Y280* probably null Het
Epha8 G T 4: 136,938,724 H374N probably benign Het
Erbin A T 13: 103,834,851 D752E probably benign Het
Fam149a A G 8: 45,381,412 S117P possibly damaging Het
Fchsd2 G A 7: 101,244,203 C304Y probably benign Het
Galnt6 C A 15: 100,697,978 V390L probably damaging Het
Gm4737 A G 16: 46,153,979 V345A probably benign Het
Gm4869 T A 5: 140,462,315 probably null Het
Grk3 T C 5: 112,973,582 probably null Het
Il17rc A T 6: 113,476,765 T237S probably benign Het
Inpp5b A G 4: 124,793,381 D800G probably damaging Het
Itga11 A G 9: 62,755,586 N528S probably benign Het
Lancl2 T A 6: 57,737,723 F442L probably benign Het
Ldah G T 12: 8,268,430 A180S possibly damaging Het
Lingo1 T C 9: 56,621,308 E5G probably benign Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Liph A T 16: 21,956,112 L445Q probably damaging Het
Lonrf1 A G 8: 36,236,081 Y314H probably damaging Het
Lrit3 A T 3: 129,800,424 L168Q probably damaging Het
Mylk4 G T 13: 32,715,967 T312K probably damaging Het
Myzap A T 9: 71,579,800 M15K probably benign Het
Ngf G A 3: 102,520,816 V298M probably damaging Het
Nlrp9a A G 7: 26,564,877 I741V probably benign Het
Nrxn2 T C 19: 6,517,034 V1313A possibly damaging Het
Nuf2 C T 1: 169,507,385 probably null Het
Olfr1031 A G 2: 85,992,120 Y101C probably benign Het
Olfr60 G A 7: 140,345,570 Q140* probably null Het
Pcdh17 C T 14: 84,532,910 R943* probably null Het
Phykpl A T 11: 51,598,385 H346L probably benign Het
Plk4 C A 3: 40,805,100 L144I probably damaging Het
Pole C A 5: 110,318,335 P1301Q probably benign Het
Prkch T A 12: 73,697,970 N252K possibly damaging Het
Psen2 A T 1: 180,240,729 probably null Het
Ptgds C A 2: 25,469,117 R42L probably benign Het
Ptprz1 A G 6: 23,000,205 T765A probably benign Het
Rab6b T C 9: 103,163,862 F152L possibly damaging Het
Rbm12b2 T A 4: 12,095,335 F731L probably damaging Het
Rnf32 T C 5: 29,224,127 I234T probably damaging Het
Scn8a T A 15: 101,035,451 I1512N probably benign Het
Senp6 T A 9: 80,092,308 D81E probably benign Het
Slc26a7 T G 4: 14,590,416 N125T possibly damaging Het
Sptlc1 A T 13: 53,358,767 I185N possibly damaging Het
Syne2 C A 12: 76,000,843 H4013N probably benign Het
Tbc1d9b T C 11: 50,171,178 V1171A probably benign Het
Tmem63b T C 17: 45,666,326 N417S probably benign Het
Ttn A G 2: 76,875,849 V9176A unknown Het
Vmn1r210 T C 13: 22,827,262 I285V probably damaging Het
Wbp11 C T 6: 136,818,023 V308I possibly damaging Het
Wnk2 A C 13: 49,076,198 V950G probably benign Het
Zfp110 A G 7: 12,844,594 N144S probably benign Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9044:5830411N06Rik UTSW 7 140248097 missense probably damaging 1.00
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9152:5830411N06Rik UTSW 7 140297343 missense possibly damaging 0.55
R9470:5830411N06Rik UTSW 7 140247432 missense probably benign 0.07
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9522:5830411N06Rik UTSW 7 140274074 missense possibly damaging 0.73
R9755:5830411N06Rik UTSW 7 140261631 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCCTCACTAGGGGACTGG -3'
(R):5'- TTTCCCCTGAGCAGATTAGTG -3'

Sequencing Primer
(F):5'- GGGTGACAGCCATCAGATCATTTC -3'
(R):5'- AGTGCAGCATCCTGATCATG -3'
Posted On 2022-11-14