Incidental Mutation 'R9795:Krt73'
ID 734904
Institutional Source Beutler Lab
Gene Symbol Krt73
Ensembl Gene ENSMUSG00000063661
Gene Name keratin 73
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock # R9795 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101793308-101802346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 101802290 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 3 (R3L)
Ref Sequence ENSEMBL: ENSMUSP00000065349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063292]
AlphaFold Q6NXH9
Predicted Effect probably damaging
Transcript: ENSMUST00000063292
AA Change: R3L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065349
Gene: ENSMUSG00000063661
AA Change: R3L

DomainStartEndE-ValueType
low complexity region 17 57 N/A INTRINSIC
Pfam:Keratin_2_head 59 127 1.4e-19 PFAM
Filament 130 443 5.39e-159 SMART
low complexity region 450 461 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,757,303 S517G unknown Het
Adamts20 C T 15: 94,403,299 G115R possibly damaging Het
Adgrl3 T C 5: 81,689,574 V701A probably damaging Het
Afap1l1 T C 18: 61,741,751 D453G possibly damaging Het
Ano1 A T 7: 144,621,697 W495R probably damaging Het
Apc T A 18: 34,314,575 L1508Q probably damaging Het
Bbs12 C T 3: 37,320,075 T224I possibly damaging Het
Cald1 A T 6: 34,746,136 M52L Het
Cdk12 T A 11: 98,211,225 D636E unknown Het
Cfap53 A G 18: 74,305,670 D306G probably benign Het
Cntnap4 T C 8: 112,881,725 V1259A probably benign Het
Cntnap5c A T 17: 58,102,197 T477S probably benign Het
Epha3 T C 16: 63,552,547 E931G probably benign Het
Fam26f T C 10: 34,126,548 I180V probably damaging Het
Foxred1 CGGG CGG 9: 35,210,856 probably null Het
Gstt1 T C 10: 75,798,557 probably benign Het
Hao1 T A 2: 134,530,632 Y152F possibly damaging Het
Hcn4 C T 9: 58,853,479 Q436* probably null Het
Hmcn1 G A 1: 150,732,938 P1498S possibly damaging Het
Igkv4-79 A G 6: 69,043,185 S49P probably damaging Het
Lrriq3 T C 3: 155,187,676 M338T probably benign Het
Ltbp2 A T 12: 84,829,354 I493N probably damaging Het
Ly6e G T 15: 74,958,541 C80F probably damaging Het
Map1a T C 2: 121,290,823 probably null Het
Mitf A G 6: 97,993,182 H137R probably benign Het
Nr1h4 T G 10: 89,478,789 T286P probably benign Het
Nsd2 A G 5: 33,846,145 D213G possibly damaging Het
Nuggc T C 14: 65,609,896 S131P probably damaging Het
Nwd2 A G 5: 63,806,889 E1272G probably damaging Het
Olfr1099 T A 2: 86,958,775 I228F probably damaging Het
Olfr1251 T C 2: 89,667,467 I140V probably benign Het
Olfr1315-ps1 T C 2: 112,110,985 H89R probably benign Het
Olfr1385 A T 11: 49,495,055 N174I probably damaging Het
Olfr199 T A 16: 59,216,575 I13F possibly damaging Het
Olfr507 A G 7: 108,622,662 I283M probably benign Het
Olfr851 T C 9: 19,497,116 Y123H probably damaging Het
Olfr862 T A 9: 19,884,051 M85L probably benign Het
Pacsin3 C A 2: 91,263,815 A363D probably benign Het
Pcdh17 C T 14: 84,532,910 R943* probably null Het
Pkhd1l1 T C 15: 44,543,587 S2407P probably benign Het
Ppip5k2 A T 1: 97,744,097 Y489* probably null Het
Qrich1 T A 9: 108,533,890 S205T probably benign Het
Rasgrp1 T C 2: 117,287,948 D520G probably benign Het
Rbm20 C A 19: 53,864,120 T1177K probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sel1l3 C A 5: 53,172,582 R477L probably benign Het
Slc27a3 C T 3: 90,389,568 W32* probably null Het
Slc5a8 T C 10: 88,921,729 I527T possibly damaging Het
Slc6a7 C A 18: 61,005,794 R214L probably benign Het
Stx7 T C 10: 24,181,577 L167P probably damaging Het
Sult1d1 T A 5: 87,564,796 N63I probably damaging Het
Ttc23l T A 15: 10,537,645 I180F probably benign Het
Usp31 A G 7: 121,648,276 S1315P probably benign Het
Usp9y T C Y: 1,364,679 M1045V probably benign Het
Vmn2r118 T C 17: 55,592,496 T803A probably damaging Het
Vmn2r97 T A 17: 18,947,299 V605D probably damaging Het
Wdr26 A G 1: 181,209,247 F143S probably damaging Het
Zfp51 T G 17: 21,461,789 probably null Het
Other mutations in Krt73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Krt73 APN 15 101798937 critical splice acceptor site probably null
IGL01768:Krt73 APN 15 101798856 missense probably benign 0.01
IGL01836:Krt73 APN 15 101795896 missense probably benign 0.38
IGL02058:Krt73 APN 15 101802021 missense probably benign
IGL02063:Krt73 APN 15 101795769 splice site probably benign
IGL02076:Krt73 APN 15 101799935 missense probably damaging 1.00
IGL02878:Krt73 APN 15 101798826 missense probably damaging 1.00
IGL03127:Krt73 APN 15 101795840 missense probably benign
R0032:Krt73 UTSW 15 101794052 missense probably benign 0.30
R0109:Krt73 UTSW 15 101796395 nonsense probably null
R0143:Krt73 UTSW 15 101800773 missense probably damaging 1.00
R0233:Krt73 UTSW 15 101802016 missense probably benign 0.12
R0233:Krt73 UTSW 15 101802016 missense probably benign 0.12
R0254:Krt73 UTSW 15 101799889 splice site probably benign
R0256:Krt73 UTSW 15 101801936 missense probably damaging 1.00
R0497:Krt73 UTSW 15 101802230 missense probably damaging 0.99
R1592:Krt73 UTSW 15 101802239 nonsense probably null
R1681:Krt73 UTSW 15 101802047 missense possibly damaging 0.70
R1696:Krt73 UTSW 15 101799909 missense probably damaging 1.00
R1766:Krt73 UTSW 15 101793928 missense probably damaging 1.00
R2031:Krt73 UTSW 15 101798764 splice site probably benign
R2171:Krt73 UTSW 15 101800910 missense possibly damaging 0.88
R4674:Krt73 UTSW 15 101802075 missense probably benign 0.22
R4777:Krt73 UTSW 15 101794001 missense probably benign
R4869:Krt73 UTSW 15 101796398 missense probably damaging 1.00
R4892:Krt73 UTSW 15 101795809 missense probably damaging 0.99
R5794:Krt73 UTSW 15 101794829 missense probably benign 0.00
R6807:Krt73 UTSW 15 101796407 missense probably damaging 1.00
R6885:Krt73 UTSW 15 101796398 missense probably damaging 1.00
R7489:Krt73 UTSW 15 101793859 missense probably benign 0.00
R7682:Krt73 UTSW 15 101802045 missense probably benign 0.08
R9167:Krt73 UTSW 15 101793970 missense probably benign 0.00
Z1177:Krt73 UTSW 15 101793811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGCCACATTGAAGGAGATG -3'
(R):5'- TTGCAAGCCCAGCACTTTG -3'

Sequencing Primer
(F):5'- AGATGCTCCTGGGACTCCTCAG -3'
(R):5'- GCCCTATGCCTATGATTTCGATAG -3'
Posted On 2022-11-14