Mutagenetix > Incidental Mutation

Incidental Mutation 'R9796:Pdzrn4'

734965

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.324) question?

Stock #

R9796 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 92680472 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 359 (F359I)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000035399
AA Change: F120I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: F120I

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169942
AA Change: F359I

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: F359I

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	C	T	10: 29,225,353	T574I	possibly damaging	Het
Aadac	T	G	3: 60,038,461	V184G	probably damaging	Het
Adam6b	G	A	12: 113,490,652	C363Y	probably damaging	Het
Adamts8	T	A	9: 30,951,273	I258N	probably damaging	Het
Adarb2	C	T	13: 8,569,816	L113F	probably damaging	Het
Aff4	A	G	11: 53,411,997	N1099S	probably damaging	Het
Alg10b	G	T	15: 90,224,525	A30S	possibly damaging	Het
Als2	T	A	1: 59,170,442	E1460D	probably benign	Het
Ascc3	C	T	10: 50,732,705	R1515*	probably null	Het
Asxl2	C	T	12: 3,496,508	P431S	probably benign	Het
AU018091	A	T	7: 3,163,955	V153D	probably damaging	Het
Cd177	A	G	7: 24,759,744	V80A	probably benign	Het
Cdc16	G	T	8: 13,757,693		probably benign	Het
Cdk14	A	G	5: 5,266,012	S4P	probably benign	Het
Ctu2	A	T	8: 122,476,250	Y8F	probably benign	Het
Dnhd1	T	C	7: 105,693,330	F1294L	probably damaging	Het
Epha7	A	G	4: 28,817,457	D37G	probably damaging	Het
Fan1	T	A	7: 64,372,530	N325I	probably benign	Het
Fbn1	T	A	2: 125,317,021	M2275L	probably benign	Het
Fbxo38	T	C	18: 62,540,984	K9E	possibly damaging	Het
Gm3696	T	C	14: 7,089,939	N48S	possibly damaging	Het
Greb1l	A	G	18: 10,538,233	E1082G	possibly damaging	Het
Gtdc1	A	T	2: 44,825,374	N52K	probably benign	Het
Hrh2	C	T	13: 54,221,222	T359I	probably benign	Het
Ifi44l	A	G	3: 151,762,782	V37A		Het
Igfn1	C	A	1: 135,969,873	W985L	probably benign	Het
Il23a	G	C	10: 128,296,960	R143G	probably benign	Het
Iltifb	A	G	10: 118,294,176	S108P	probably benign	Het
Kcnv1	T	C	15: 45,114,591	D17G	unknown	Het
Klk1	T	C	7: 44,228,541	W74R	possibly damaging	Het
Lmntd2	A	T	7: 141,213,684	N96K	possibly damaging	Het
Lrch4	A	G	5: 137,637,007	H253R	probably damaging	Het
Lrrc8d	A	T	5: 105,812,051	D109V	probably benign	Het
Magi3	T	C	3: 104,020,975	T1004A	probably benign	Het
Mapk10	A	G	5: 102,987,235	V287A	possibly damaging	Het
Mtss1l	G	A	8: 110,730,121		probably null	Het
Mybpc1	T	C	10: 88,570,635	I116V	possibly damaging	Het
Mylk4	T	A	13: 32,716,660	M296L	probably damaging	Het
Nav3	A	G	10: 109,692,108	F2238S	probably damaging	Het
Olfr742	G	T	14: 50,515,772	L189F	probably damaging	Het
Park2	A	T	17: 11,237,667	D126V	possibly damaging	Het
Pax6	T	C	2: 105,692,196	F243L	probably damaging	Het
Pcdhb22	G	A	18: 37,519,351	E34K	possibly damaging	Het
Rnf168	C	T	16: 32,299,054	R478C	probably damaging	Het
Sh3gl2	G	A	4: 85,377,528	V156I	possibly damaging	Het
Taf2	A	T	15: 55,047,436	M614K	probably damaging	Het
Tbc1d31	G	A	15: 57,969,783	V973M	probably damaging	Het
Tmem131l	T	G	3: 83,922,095	K1085T	probably damaging	Het
Tpst1	A	G	5: 130,134,459	T366A	probably benign	Het
Unc50	A	G	1: 37,432,598	T110A	probably benign	Het
Vmn2r60	A	G	7: 42,135,748	H128R	probably benign	Het
Vps13a	A	T	19: 16,654,464	N2602K	probably benign	Het
Vps13d	A	G	4: 145,127,935		probably null	Het
Vps50	A	G	6: 3,562,300	E465G	probably damaging	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCAGAATTGAGGGGCTTCACC -3'
(R):5'- TGATAGACGAATAACCAATGCCAAG -3'

Sequencing Primer
(F):5'- TTCACCCATGAAGAGAAAGGAAAGC -3'
(R):5'- TGCCAAGCTACTCAAAAGATCTTATC -3'

Posted On

2022-11-14