Mutagenetix > Incidental Mutation

Incidental Mutation 'R9798:Alpk3'

735052

Institutional Source

Beutler Lab

Gene Symbol

Alpk3

Ensembl Gene

ENSMUSG00000038763

Gene Name

alpha-kinase 3

Synonyms

Midori

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.322) question?

Stock #

R9798 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81057600-81105612 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81092652 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 739 (M739K)

Ref Sequence

ENSEMBL: ENSMUSP00000102971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107348]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000107348
AA Change: M739K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: M739K

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
IGc2	89	159	2.78e-11	SMART
low complexity region	183	192	N/A	INTRINSIC
low complexity region	400	427	N/A	INTRINSIC
low complexity region	514	532	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	958	971	N/A	INTRINSIC
low complexity region	1048	1058	N/A	INTRINSIC
low complexity region	1076	1087	N/A	INTRINSIC
IG_like	1264	1330	5.73e-2	SMART
low complexity region	1350	1359	N/A	INTRINSIC
Alpha_kinase	1395	1592	1.17e-44	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,853,120	S201T	possibly damaging	Het
Adamtsl1	A	G	4: 86,156,690	D98G	probably damaging	Het
Ahnak	A	G	19: 9,013,619	D4089G	probably damaging	Het
Asns	T	C	6: 7,689,395	N36D	possibly damaging	Het
Bbs7	A	T	3: 36,598,290	M338K	probably benign	Het
Bbx	T	C	16: 50,224,758	D480G	probably damaging	Het
BC037034	A	G	5: 138,261,678	M372T	possibly damaging	Het
Cc2d2b	G	A	19: 40,794,636	V626I	unknown	Het
Celsr3	A	T	9: 108,828,595	D759V	probably damaging	Het
Entpd1	G	A	19: 40,727,345	V319M	possibly damaging	Het
Espnl	G	T	1: 91,323,564	G127V	probably damaging	Het
Fgfr1	C	T	8: 25,563,507	T266I	unknown	Het
Fktn	C	T	4: 53,747,128	H344Y	probably damaging	Het
Fryl	T	C	5: 73,035,059	M2678V	probably benign	Het
Fsip2	T	A	2: 82,979,881	Y2181*	probably null	Het
Gm21698	A	T	5: 25,984,186	D256E	probably damaging	Het
Hipk1	C	T	3: 103,744,115	V1156I	possibly damaging	Het
Igsf10	T	A	3: 59,331,705	I352F	probably damaging	Het
Igsf5	C	A	16: 96,372,875	T35K	probably damaging	Het
Il23a	G	C	10: 128,296,960	R143G	probably benign	Het
Kctd11	T	G	11: 69,879,906	H102P	probably damaging	Het
Msln	T	C	17: 25,753,797	T37A	probably benign	Het
Olfr1037	T	C	2: 86,085,262	N172D	probably damaging	Het
Olfr847	T	A	9: 19,375,281	Y200F	probably benign	Het
Phtf1	T	C	3: 103,997,553	S506P	probably benign	Het
Pias3	T	C	3: 96,699,565	I57T	probably damaging	Het
Psmc2	A	G	5: 21,795,808	I94V	probably benign	Het
Ripor1	T	C	8: 105,616,166	Y224H	possibly damaging	Het
Rrh	C	T	3: 129,811,772	V229M	probably damaging	Het
Scaf4	G	A	16: 90,248,645	R526C	unknown	Het
Slc1a6	G	A	10: 78,793,333		probably null	Het
Slc4a7	A	G	14: 14,782,056	D937G	probably damaging	Het
Slco1b2	C	A	6: 141,655,353	T134K	probably damaging	Het
Sptbn4	T	C	7: 27,357,292	*2562W	probably null	Het
Ston1	T	C	17: 88,637,044	V626A	probably damaging	Het
Synpo	A	T	18: 60,603,760	D371E	possibly damaging	Het
Tex15	T	A	8: 33,572,693	V717D	probably damaging	Het
Tmod3	G	C	9: 75,529,521	A44G	probably damaging	Het
Tmod3	A	C	9: 75,529,523	N43K	probably damaging	Het
Tmod3	G	T	9: 75,529,519	L45I	possibly damaging	Het
Top2b	T	C	14: 16,389,845	F228L	probably damaging	Het
Ush2a	A	G	1: 188,911,805	T4455A	possibly damaging	Het
Vmn1r178	C	A	7: 23,894,308	Y260*	probably null	Het
Vps13c	T	A	9: 67,919,364	I1429N	probably damaging	Het
Wdr31	A	G	4: 62,463,414	V60A	probably benign	Het

Other mutations in Alpk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Alpk3	APN	7	81078009	missense	possibly damaging	0.95
IGL00472:Alpk3	APN	7	81095653	splice site	probably benign
IGL01732:Alpk3	APN	7	81057642	missense	unknown
IGL01750:Alpk3	APN	7	81092282	missense	probably damaging	1.00
IGL01812:Alpk3	APN	7	81100202	missense	probably damaging	1.00
IGL02224:Alpk3	APN	7	81076868	splice site	probably benign
IGL02292:Alpk3	APN	7	81077905	missense	possibly damaging	0.46
IGL02340:Alpk3	APN	7	81078507	missense	probably benign	0.03
IGL02517:Alpk3	APN	7	81077895	missense	probably benign	0.00
IGL02725:Alpk3	APN	7	81093610	missense	possibly damaging	0.91
IGL02755:Alpk3	APN	7	81093759	missense	possibly damaging	0.71
IGL03035:Alpk3	APN	7	81078604	missense	probably benign	0.00
IGL03102:Alpk3	APN	7	81095056	critical splice donor site	probably null
IGL03153:Alpk3	APN	7	81093395	missense	probably benign	0.00
IGL03255:Alpk3	APN	7	81092562	missense	probably benign	0.01
IGL03367:Alpk3	APN	7	81094990	missense	probably benign	0.01
FR4304:Alpk3	UTSW	7	81077762	small insertion	probably benign
FR4737:Alpk3	UTSW	7	81077762	small insertion	probably benign
IGL03097:Alpk3	UTSW	7	81093909	missense	probably benign	0.00
R0092:Alpk3	UTSW	7	81092553	missense	probably benign
R0254:Alpk3	UTSW	7	81076974	missense	probably benign	0.43
R0310:Alpk3	UTSW	7	81078610	missense	possibly damaging	0.61
R0325:Alpk3	UTSW	7	81067953	missense	possibly damaging	0.58
R0387:Alpk3	UTSW	7	81104227	missense	possibly damaging	0.93
R0971:Alpk3	UTSW	7	81092579	missense	possibly damaging	0.55
R1078:Alpk3	UTSW	7	81078600	missense	probably benign
R1146:Alpk3	UTSW	7	81077595	missense	probably damaging	0.99
R1146:Alpk3	UTSW	7	81077595	missense	probably damaging	0.99
R1168:Alpk3	UTSW	7	81103357	missense	probably damaging	1.00
R1306:Alpk3	UTSW	7	81093873	missense	probably damaging	1.00
R1822:Alpk3	UTSW	7	81076931	nonsense	probably null
R2173:Alpk3	UTSW	7	81076900	missense	probably damaging	1.00
R2350:Alpk3	UTSW	7	81094970	missense	probably damaging	1.00
R2414:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R2417:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R2885:Alpk3	UTSW	7	81100192	missense	probably damaging	1.00
R3004:Alpk3	UTSW	7	81103355	nonsense	probably null
R3796:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3797:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3798:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3799:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3894:Alpk3	UTSW	7	81078390	missense	possibly damaging	0.93
R4395:Alpk3	UTSW	7	81094955	missense	probably damaging	1.00
R4761:Alpk3	UTSW	7	81104168	missense	probably damaging	0.99
R5505:Alpk3	UTSW	7	81078561	missense	possibly damaging	0.87
R5540:Alpk3	UTSW	7	81095436	missense	probably damaging	1.00
R5770:Alpk3	UTSW	7	81078562	missense	probably benign	0.02
R5941:Alpk3	UTSW	7	81078653	missense	probably damaging	1.00
R5964:Alpk3	UTSW	7	81092260	missense	possibly damaging	0.88
R6036:Alpk3	UTSW	7	81093257	missense	probably benign	0.34
R6036:Alpk3	UTSW	7	81093257	missense	probably benign	0.34
R6066:Alpk3	UTSW	7	81076950	missense	possibly damaging	0.89
R6517:Alpk3	UTSW	7	81078579	missense	possibly damaging	0.54
R6578:Alpk3	UTSW	7	81078684	missense	probably benign	0.00
R7230:Alpk3	UTSW	7	81093294	missense	probably damaging	1.00
R7266:Alpk3	UTSW	7	81092580	missense	possibly damaging	0.55
R7271:Alpk3	UTSW	7	81078454	missense	possibly damaging	0.92
R7402:Alpk3	UTSW	7	81076912	missense	probably benign	0.29
R7411:Alpk3	UTSW	7	81092852	missense	probably benign	0.11
R7454:Alpk3	UTSW	7	81078562	missense	probably benign	0.02
R7468:Alpk3	UTSW	7	81100998	nonsense	probably null
R7940:Alpk3	UTSW	7	81093945	missense	probably damaging	1.00
R8157:Alpk3	UTSW	7	81093722	missense	probably benign	0.00
R8246:Alpk3	UTSW	7	81092776	missense	probably benign	0.00
R8357:Alpk3	UTSW	7	81093318	missense	probably damaging	1.00
R8444:Alpk3	UTSW	7	81057720	missense	probably benign	0.08
R8457:Alpk3	UTSW	7	81093318	missense	probably damaging	1.00
R8775:Alpk3	UTSW	7	81077850	missense	probably benign	0.00
R8775-TAIL:Alpk3	UTSW	7	81077850	missense	probably benign	0.00
R8794:Alpk3	UTSW	7	81057655	missense	unknown
R8982:Alpk3	UTSW	7	81099002	missense	probably damaging	1.00
R9259:Alpk3	UTSW	7	81093554	missense	probably damaging	1.00
R9343:Alpk3	UTSW	7	81092331	missense	probably benign	0.27
R9567:Alpk3	UTSW	7	81092939	missense	possibly damaging	0.55
R9792:Alpk3	UTSW	7	81101133	critical splice donor site	probably null
R9793:Alpk3	UTSW	7	81101133	critical splice donor site	probably null
RF034:Alpk3	UTSW	7	81092414	small deletion	probably benign
RF057:Alpk3	UTSW	7	81092417	frame shift	probably null
X0022:Alpk3	UTSW	7	81093897	missense	probably damaging	0.96
Z1176:Alpk3	UTSW	7	81078626	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACAGTCAGACAGGAGTTCATGG -3'
(R):5'- GTAGGTACGGTTCCCTGATG -3'

Sequencing Primer
(F):5'- GTTCATGGAAGAATTTGGTGACAC -3'
(R):5'- GCCTAGCAGCCCATCCTCATG -3'

Posted On

2022-11-14