Incidental Mutation 'R9798:Igsf5'
ID 735070
Institutional Source Beutler Lab
Gene Symbol Igsf5
Ensembl Gene ENSMUSG00000000159
Gene Name immunoglobulin superfamily, member 5
Synonyms Igsf5, Jam4, 2010003D20Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R9798 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 96162868-96223321 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 96174075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 35 (T35K)
Ref Sequence ENSEMBL: ENSMUSP00000109425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000163] [ENSMUST00000081093] [ENSMUST00000113794] [ENSMUST00000113795]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000000163
AA Change: T35K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000163
Gene: ENSMUSG00000000159
AA Change: T35K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081093
AA Change: T35K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079874
Gene: ENSMUSG00000000159
AA Change: T35K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113794
AA Change: T35K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159
AA Change: T35K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113795
AA Change: T35K
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159
AA Change: T35K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 61,000,934 (GRCm39) S201T possibly damaging Het
Adamtsl1 A G 4: 86,074,927 (GRCm39) D98G probably damaging Het
Ahnak A G 19: 8,990,983 (GRCm39) D4089G probably damaging Het
Alpk3 T A 7: 80,742,400 (GRCm39) M739K probably benign Het
Asns T C 6: 7,689,395 (GRCm39) N36D possibly damaging Het
Bbs7 A T 3: 36,652,439 (GRCm39) M338K probably benign Het
Bbx T C 16: 50,045,121 (GRCm39) D480G probably damaging Het
Cc2d2b G A 19: 40,783,080 (GRCm39) V626I unknown Het
Celsr3 A T 9: 108,705,794 (GRCm39) D759V probably damaging Het
Entpd1 G A 19: 40,715,789 (GRCm39) V319M possibly damaging Het
Espnl G T 1: 91,251,286 (GRCm39) G127V probably damaging Het
Fgfr1 C T 8: 26,053,523 (GRCm39) T266I unknown Het
Fktn C T 4: 53,747,128 (GRCm39) H344Y probably damaging Het
Fryl T C 5: 73,192,402 (GRCm39) M2678V probably benign Het
Fsip2 T A 2: 82,810,225 (GRCm39) Y2181* probably null Het
Gm21698 A T 5: 26,189,184 (GRCm39) D256E probably damaging Het
Hipk1 C T 3: 103,651,431 (GRCm39) V1156I possibly damaging Het
Igsf10 T A 3: 59,239,126 (GRCm39) I352F probably damaging Het
Il23a G C 10: 128,132,829 (GRCm39) R143G probably benign Het
Kctd11 T G 11: 69,770,732 (GRCm39) H102P probably damaging Het
Msln T C 17: 25,972,771 (GRCm39) T37A probably benign Het
Or7g29 T A 9: 19,286,577 (GRCm39) Y200F probably benign Het
Or8u10 T C 2: 85,915,606 (GRCm39) N172D probably damaging Het
Phtf1 T C 3: 103,904,869 (GRCm39) S506P probably benign Het
Pias3 T C 3: 96,606,881 (GRCm39) I57T probably damaging Het
Psmc2 A G 5: 22,000,806 (GRCm39) I94V probably benign Het
Ripor1 T C 8: 106,342,798 (GRCm39) Y224H possibly damaging Het
Rrh C T 3: 129,605,421 (GRCm39) V229M probably damaging Het
Scaf4 G A 16: 90,045,533 (GRCm39) R526C unknown Het
Slc1a6 G A 10: 78,629,167 (GRCm39) probably null Het
Slc4a7 A G 14: 14,782,056 (GRCm38) D937G probably damaging Het
Slco1b2 C A 6: 141,601,079 (GRCm39) T134K probably damaging Het
Sptbn4 T C 7: 27,056,717 (GRCm39) *2562W probably null Het
Ston1 T C 17: 88,944,472 (GRCm39) V626A probably damaging Het
Synpo A T 18: 60,736,832 (GRCm39) D371E possibly damaging Het
Tex15 T A 8: 34,062,721 (GRCm39) V717D probably damaging Het
Tmod3 A C 9: 75,436,805 (GRCm39) N43K probably damaging Het
Tmod3 G T 9: 75,436,801 (GRCm39) L45I possibly damaging Het
Tmod3 G C 9: 75,436,803 (GRCm39) A44G probably damaging Het
Top2b T C 14: 16,389,845 (GRCm38) F228L probably damaging Het
Trappc14 A G 5: 138,259,940 (GRCm39) M372T possibly damaging Het
Ush2a A G 1: 188,644,002 (GRCm39) T4455A possibly damaging Het
Vmn1r178 C A 7: 23,593,733 (GRCm39) Y260* probably null Het
Vps13c T A 9: 67,826,646 (GRCm39) I1429N probably damaging Het
Wdr31 A G 4: 62,381,651 (GRCm39) V60A probably benign Het
Other mutations in Igsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Igsf5 APN 16 96,192,220 (GRCm39) missense possibly damaging 0.72
IGL01335:Igsf5 APN 16 96,174,353 (GRCm39) splice site probably benign
IGL02576:Igsf5 APN 16 96,187,781 (GRCm39) missense probably benign 0.23
IGL02721:Igsf5 APN 16 96,192,222 (GRCm39) missense probably damaging 0.98
IGL03289:Igsf5 APN 16 96,326,632 (GRCm39) missense possibly damaging 0.94
R0630:Igsf5 UTSW 16 96,174,023 (GRCm39) splice site probably benign
R1858:Igsf5 UTSW 16 96,187,829 (GRCm39) splice site probably null
R1961:Igsf5 UTSW 16 96,179,551 (GRCm39) missense probably damaging 1.00
R2508:Igsf5 UTSW 16 96,165,247 (GRCm39) missense probably benign 0.01
R4491:Igsf5 UTSW 16 96,165,281 (GRCm39) missense probably benign 0.02
R5123:Igsf5 UTSW 16 96,174,279 (GRCm39) missense probably damaging 1.00
R5262:Igsf5 UTSW 16 96,192,237 (GRCm39) nonsense probably null
R5384:Igsf5 UTSW 16 96,192,226 (GRCm39) missense probably benign 0.21
R5558:Igsf5 UTSW 16 96,187,731 (GRCm39) missense possibly damaging 0.95
R5950:Igsf5 UTSW 16 96,174,072 (GRCm39) missense probably benign 0.07
R5957:Igsf5 UTSW 16 96,165,249 (GRCm39) missense probably benign 0.10
R6199:Igsf5 UTSW 16 96,222,939 (GRCm39) missense possibly damaging 0.66
R6298:Igsf5 UTSW 16 96,197,648 (GRCm39) missense possibly damaging 0.93
R7164:Igsf5 UTSW 16 96,174,048 (GRCm39) missense possibly damaging 0.85
R7197:Igsf5 UTSW 16 96,204,546 (GRCm39) missense probably damaging 1.00
R8213:Igsf5 UTSW 16 96,174,188 (GRCm39) missense probably damaging 1.00
R8353:Igsf5 UTSW 16 96,222,996 (GRCm39) missense probably benign 0.00
R8453:Igsf5 UTSW 16 96,222,996 (GRCm39) missense probably benign 0.00
R8823:Igsf5 UTSW 16 96,222,939 (GRCm39) missense possibly damaging 0.66
Z1176:Igsf5 UTSW 16 96,192,223 (GRCm39) missense probably damaging 1.00
Z1177:Igsf5 UTSW 16 96,179,533 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGCCATGTGTCTACCAGAAG -3'
(R):5'- TCCGAGATGAAGCTGTCAGTG -3'

Sequencing Primer
(F):5'- GCCATGTGTCTACCAGAAGTCCTG -3'
(R):5'- AAGCTGTCAGTGCTGTTGTAAC -3'
Posted On 2022-11-14