Incidental Mutation 'R9800:Vps16'
ID 735141
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock # R9800 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130424339-130444269 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130440485 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 413 (F413L)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028900
AA Change: F413L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: F413L

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,520,060 I1009N possibly damaging Het
Adcy8 T A 15: 64,699,246 N1213Y probably benign Het
Ahctf1 T C 1: 179,753,868 S1590G possibly damaging Het
Ahcyl1 A T 3: 107,670,272 N277K probably damaging Het
Ank2 A T 3: 126,946,500 S1912T unknown Het
Ank3 T A 10: 69,898,127 N740K unknown Het
Atp13a3 A C 16: 30,340,233 I800S probably benign Het
AU041133 T A 10: 82,150,845 C111S probably damaging Het
Azi2 T A 9: 118,055,856 I211N probably benign Het
Btbd11 C A 10: 85,388,215 A296E unknown Het
Camk2b T C 11: 5,972,408 N480S probably damaging Het
Card6 A G 15: 5,099,220 V898A probably benign Het
Copb2 T A 9: 98,579,028 M381K probably damaging Het
Crisp1 A T 17: 40,305,180 M102K probably damaging Het
Dcxr A T 11: 120,727,258 probably benign Het
Dennd5a C A 7: 109,901,167 R917L probably benign Het
Egflam T A 15: 7,250,044 T494S probably benign Het
Fkbpl T A 17: 34,645,717 M153K probably benign Het
Helz2 A T 2: 181,240,823 I59N probably damaging Het
Ldlrap1 T C 4: 134,749,992 T194A probably benign Het
Lman1l T C 9: 57,615,777 D133G probably damaging Het
Lrrc27 T C 7: 139,227,997 M340T probably benign Het
Lum T A 10: 97,568,295 S17R probably benign Het
Malrd1 A G 2: 15,842,594 K1182E unknown Het
Map3k2 A T 18: 32,200,016 D81V possibly damaging Het
Muc5b A T 7: 141,861,743 T2809S possibly damaging Het
Nle1 C A 11: 82,903,050 V387L probably benign Het
Nr1h4 T C 10: 89,454,756 D474G probably benign Het
Nup205 T C 6: 35,186,533 I144T possibly damaging Het
Olfr1122 G T 2: 87,388,164 C153F probably damaging Het
Olfr1309 G A 2: 111,983,849 S75L possibly damaging Het
Olfr23 C A 11: 73,941,160 L305I probably benign Het
Olfr444 A T 6: 42,956,157 I220F probably damaging Het
Olfr566 T C 7: 102,856,886 Y132C probably benign Het
Olfr732 G A 14: 50,282,244 T3I probably benign Het
Pkn3 C T 2: 30,083,278 R371* probably null Het
Plin2 A T 4: 86,668,505 S30T possibly damaging Het
Ppfibp1 T C 6: 147,016,271 V475A probably benign Het
Ppp2ca T C 11: 52,118,083 Y137H probably damaging Het
Rasgrf2 T A 13: 92,131,352 Q48L probably damaging Het
Rnf168 G C 16: 32,298,568 V316L probably benign Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Spata31d1d T C 13: 59,726,823 H966R possibly damaging Het
Speg C A 1: 75,422,714 D2268E probably benign Het
Srp54c A G 12: 55,250,026 I170V probably benign Het
Syde2 A G 3: 145,998,609 R439G probably benign Het
Tcof1 T C 18: 60,816,486 K1155R unknown Het
Tmem184c T C 8: 77,596,458 I592V probably benign Het
Trav6-7-dv9 A G 14: 53,710,212 Y57C probably damaging Het
Trpc1 T A 9: 95,743,250 I108F probably damaging Het
Virma A T 4: 11,546,007 H1615L probably damaging Het
Vmn2r10 A T 5: 109,002,538 D213E probably damaging Het
Vmn2r116 T A 17: 23,401,425 V711E probably damaging Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Wasf1 T C 10: 40,936,697 I494T unknown Het
Wdr36 A G 18: 32,852,647 D539G possibly damaging Het
Zfp81 A T 17: 33,335,437 C134* probably null Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
R9092:Vps16 UTSW 2 130439673 missense probably damaging 0.99
R9128:Vps16 UTSW 2 130424399 missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130441903 critical splice donor site probably null
R9406:Vps16 UTSW 2 130441505 critical splice donor site probably null
R9508:Vps16 UTSW 2 130442441 missense possibly damaging 0.94
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGTACCTGCGGGAGATC -3'
(R):5'- GGATCTGCAGACCACATCTC -3'

Sequencing Primer
(F):5'- CAGCAGTGCATTGAGGCTG -3'
(R):5'- GCAGACCACATCTCCTGCC -3'
Posted On 2022-11-14