Incidental Mutation 'R9800:Lman1l'
ID 735161
Institutional Source Beutler Lab
Gene Symbol Lman1l
Ensembl Gene ENSMUSG00000056271
Gene Name lectin, mannose-binding 1 like
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9800 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 57607085-57620774 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57615777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 133 (D133G)
Ref Sequence ENSEMBL: ENSMUSP00000091352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044937] [ENSMUST00000093832]
AlphaFold Q8VCD3
Predicted Effect probably damaging
Transcript: ENSMUST00000044937
AA Change: D133G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041631
Gene: ENSMUSG00000056271
AA Change: D133G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Lectin_leg-like 32 256 1.2e-53 PFAM
low complexity region 272 287 N/A INTRINSIC
coiled coil region 316 337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093832
AA Change: D133G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091352
Gene: ENSMUSG00000056271
AA Change: D133G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Lectin_leg-like 32 256 2.7e-53 PFAM
low complexity region 272 287 N/A INTRINSIC
coiled coil region 316 337 N/A INTRINSIC
transmembrane domain 439 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mannose-binding type 1 transmembrane protein that contains an N-terminal lectin-like carbohydrate recognition domain. The encoded protein is similar in structure to lectins found in leguminous plants. This lectin is thought to transport newly synthesized glycoproteins from the endoplasmic reticulum (ER) to the ER-Golgi intermediate compartment. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,520,060 I1009N possibly damaging Het
Adcy8 T A 15: 64,699,246 N1213Y probably benign Het
Ahctf1 T C 1: 179,753,868 S1590G possibly damaging Het
Ahcyl1 A T 3: 107,670,272 N277K probably damaging Het
Ank2 A T 3: 126,946,500 S1912T unknown Het
Ank3 T A 10: 69,898,127 N740K unknown Het
Atp13a3 A C 16: 30,340,233 I800S probably benign Het
AU041133 T A 10: 82,150,845 C111S probably damaging Het
Azi2 T A 9: 118,055,856 I211N probably benign Het
Btbd11 C A 10: 85,388,215 A296E unknown Het
Camk2b T C 11: 5,972,408 N480S probably damaging Het
Card6 A G 15: 5,099,220 V898A probably benign Het
Copb2 T A 9: 98,579,028 M381K probably damaging Het
Crisp1 A T 17: 40,305,180 M102K probably damaging Het
Dcxr A T 11: 120,727,258 probably benign Het
Dennd5a C A 7: 109,901,167 R917L probably benign Het
Egflam T A 15: 7,250,044 T494S probably benign Het
Fkbpl T A 17: 34,645,717 M153K probably benign Het
Helz2 A T 2: 181,240,823 I59N probably damaging Het
Ldlrap1 T C 4: 134,749,992 T194A probably benign Het
Lrrc27 T C 7: 139,227,997 M340T probably benign Het
Lum T A 10: 97,568,295 S17R probably benign Het
Malrd1 A G 2: 15,842,594 K1182E unknown Het
Map3k2 A T 18: 32,200,016 D81V possibly damaging Het
Muc5b A T 7: 141,861,743 T2809S possibly damaging Het
Nle1 C A 11: 82,903,050 V387L probably benign Het
Nr1h4 T C 10: 89,454,756 D474G probably benign Het
Nup205 T C 6: 35,186,533 I144T possibly damaging Het
Olfr1122 G T 2: 87,388,164 C153F probably damaging Het
Olfr1309 G A 2: 111,983,849 S75L possibly damaging Het
Olfr23 C A 11: 73,941,160 L305I probably benign Het
Olfr444 A T 6: 42,956,157 I220F probably damaging Het
Olfr566 T C 7: 102,856,886 Y132C probably benign Het
Olfr732 G A 14: 50,282,244 T3I probably benign Het
Pkn3 C T 2: 30,083,278 R371* probably null Het
Plin2 A T 4: 86,668,505 S30T possibly damaging Het
Ppfibp1 T C 6: 147,016,271 V475A probably benign Het
Ppp2ca T C 11: 52,118,083 Y137H probably damaging Het
Rasgrf2 T A 13: 92,131,352 Q48L probably damaging Het
Rnf168 G C 16: 32,298,568 V316L probably benign Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Spata31d1d T C 13: 59,726,823 H966R possibly damaging Het
Speg C A 1: 75,422,714 D2268E probably benign Het
Srp54c A G 12: 55,250,026 I170V probably benign Het
Syde2 A G 3: 145,998,609 R439G probably benign Het
Tcof1 T C 18: 60,816,486 K1155R unknown Het
Tmem184c T C 8: 77,596,458 I592V probably benign Het
Trav6-7-dv9 A G 14: 53,710,212 Y57C probably damaging Het
Trpc1 T A 9: 95,743,250 I108F probably damaging Het
Virma A T 4: 11,546,007 H1615L probably damaging Het
Vmn2r10 A T 5: 109,002,538 D213E probably damaging Het
Vmn2r116 T A 17: 23,401,425 V711E probably damaging Het
Vps16 T C 2: 130,440,485 F413L probably benign Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Wasf1 T C 10: 40,936,697 I494T unknown Het
Wdr36 A G 18: 32,852,647 D539G possibly damaging Het
Zfp81 A T 17: 33,335,437 C134* probably null Het
Other mutations in Lman1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Lman1l APN 9 57620564 missense probably damaging 1.00
IGL03164:Lman1l APN 9 57609995 missense probably damaging 0.99
IGL03226:Lman1l APN 9 57610007 missense probably benign 0.43
PIT4283001:Lman1l UTSW 9 57616076 missense probably damaging 1.00
R0555:Lman1l UTSW 9 57614101 missense probably benign 0.15
R1168:Lman1l UTSW 9 57608312 missense probably benign 0.00
R1169:Lman1l UTSW 9 57609995 missense probably damaging 0.99
R1591:Lman1l UTSW 9 57615802 missense probably benign 0.30
R2289:Lman1l UTSW 9 57613658 missense possibly damaging 0.76
R3848:Lman1l UTSW 9 57608317 missense possibly damaging 0.48
R4685:Lman1l UTSW 9 57609200 missense probably damaging 0.98
R5170:Lman1l UTSW 9 57615619 nonsense probably null
R5309:Lman1l UTSW 9 57611077 missense probably damaging 0.98
R5312:Lman1l UTSW 9 57611077 missense probably damaging 0.98
R5639:Lman1l UTSW 9 57611866 missense probably benign 0.24
R5655:Lman1l UTSW 9 57615975 missense probably damaging 1.00
R5905:Lman1l UTSW 9 57608263 missense probably damaging 1.00
R6011:Lman1l UTSW 9 57615755 missense probably damaging 1.00
R6028:Lman1l UTSW 9 57608263 missense probably damaging 1.00
R6035:Lman1l UTSW 9 57611747 critical splice donor site probably null
R6035:Lman1l UTSW 9 57611747 critical splice donor site probably null
R6250:Lman1l UTSW 9 57615624 missense probably benign 0.00
R6488:Lman1l UTSW 9 57620643 missense possibly damaging 0.73
R6489:Lman1l UTSW 9 57613726 splice site probably null
R6720:Lman1l UTSW 9 57614072 splice site probably null
R7000:Lman1l UTSW 9 57615948 missense probably benign 0.27
R7139:Lman1l UTSW 9 57615596 missense probably benign 0.37
R8822:Lman1l UTSW 9 57607188 missense probably benign 0.00
X0057:Lman1l UTSW 9 57615957 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATCAGCAAGGGTCTCAGG -3'
(R):5'- CAGATGAGAGTGACTGGACC -3'

Sequencing Primer
(F):5'- CATCAGCAAGGGTCTCAGGTCTAG -3'
(R):5'- AGTGACTGGACCAGGACGC -3'
Posted On 2022-11-14