Incidental Mutation 'R9800:Vmn2r116'
ID 735186
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Name vomeronasal 2, receptor 116
Synonyms V2Rp5, EG619697
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9800 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23384803-23401864 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23401425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 711 (V711E)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
AlphaFold E9Q6I0
Predicted Effect probably damaging
Transcript: ENSMUST00000164856
AA Change: V711E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: V711E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,520,060 I1009N possibly damaging Het
Adcy8 T A 15: 64,699,246 N1213Y probably benign Het
Ahctf1 T C 1: 179,753,868 S1590G possibly damaging Het
Ahcyl1 A T 3: 107,670,272 N277K probably damaging Het
Ank2 A T 3: 126,946,500 S1912T unknown Het
Ank3 T A 10: 69,898,127 N740K unknown Het
Atp13a3 A C 16: 30,340,233 I800S probably benign Het
AU041133 T A 10: 82,150,845 C111S probably damaging Het
Azi2 T A 9: 118,055,856 I211N probably benign Het
Btbd11 C A 10: 85,388,215 A296E unknown Het
Camk2b T C 11: 5,972,408 N480S probably damaging Het
Card6 A G 15: 5,099,220 V898A probably benign Het
Copb2 T A 9: 98,579,028 M381K probably damaging Het
Crisp1 A T 17: 40,305,180 M102K probably damaging Het
Dcxr A T 11: 120,727,258 probably benign Het
Dennd5a C A 7: 109,901,167 R917L probably benign Het
Egflam T A 15: 7,250,044 T494S probably benign Het
Fkbpl T A 17: 34,645,717 M153K probably benign Het
Helz2 A T 2: 181,240,823 I59N probably damaging Het
Ldlrap1 T C 4: 134,749,992 T194A probably benign Het
Lman1l T C 9: 57,615,777 D133G probably damaging Het
Lrrc27 T C 7: 139,227,997 M340T probably benign Het
Lum T A 10: 97,568,295 S17R probably benign Het
Malrd1 A G 2: 15,842,594 K1182E unknown Het
Map3k2 A T 18: 32,200,016 D81V possibly damaging Het
Muc5b A T 7: 141,861,743 T2809S possibly damaging Het
Nle1 C A 11: 82,903,050 V387L probably benign Het
Nr1h4 T C 10: 89,454,756 D474G probably benign Het
Nup205 T C 6: 35,186,533 I144T possibly damaging Het
Olfr1122 G T 2: 87,388,164 C153F probably damaging Het
Olfr1309 G A 2: 111,983,849 S75L possibly damaging Het
Olfr23 C A 11: 73,941,160 L305I probably benign Het
Olfr444 A T 6: 42,956,157 I220F probably damaging Het
Olfr566 T C 7: 102,856,886 Y132C probably benign Het
Olfr732 G A 14: 50,282,244 T3I probably benign Het
Pkn3 C T 2: 30,083,278 R371* probably null Het
Plin2 A T 4: 86,668,505 S30T possibly damaging Het
Ppfibp1 T C 6: 147,016,271 V475A probably benign Het
Ppp2ca T C 11: 52,118,083 Y137H probably damaging Het
Rasgrf2 T A 13: 92,131,352 Q48L probably damaging Het
Rnf168 G C 16: 32,298,568 V316L probably benign Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Spata31d1d T C 13: 59,726,823 H966R possibly damaging Het
Speg C A 1: 75,422,714 D2268E probably benign Het
Srp54c A G 12: 55,250,026 I170V probably benign Het
Syde2 A G 3: 145,998,609 R439G probably benign Het
Tcof1 T C 18: 60,816,486 K1155R unknown Het
Tmem184c T C 8: 77,596,458 I592V probably benign Het
Trav6-7-dv9 A G 14: 53,710,212 Y57C probably damaging Het
Trpc1 T A 9: 95,743,250 I108F probably damaging Het
Virma A T 4: 11,546,007 H1615L probably damaging Het
Vmn2r10 A T 5: 109,002,538 D213E probably damaging Het
Vps16 T C 2: 130,440,485 F413L probably benign Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Wasf1 T C 10: 40,936,697 I494T unknown Het
Wdr36 A G 18: 32,852,647 D539G possibly damaging Het
Zfp81 A T 17: 33,335,437 C134* probably null Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
R8950:Vmn2r116 UTSW 17 23401493 missense probably damaging 1.00
R8956:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R8977:Vmn2r116 UTSW 17 23386942 missense possibly damaging 0.56
R9030:Vmn2r116 UTSW 17 23384890 missense possibly damaging 0.82
R9077:Vmn2r116 UTSW 17 23385982 missense probably benign 0.14
R9223:Vmn2r116 UTSW 17 23401167 missense probably damaging 1.00
R9401:Vmn2r116 UTSW 17 23401592 missense probably damaging 1.00
R9449:Vmn2r116 UTSW 17 23386945 missense probably benign 0.01
R9746:Vmn2r116 UTSW 17 23401823 missense probably benign 0.08
R9755:Vmn2r116 UTSW 17 23401091 missense probably damaging 1.00
R9759:Vmn2r116 UTSW 17 23401386 missense possibly damaging 0.90
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATTCTACAACAACTCACATTTGG -3'
(R):5'- TGCAGAACACCAGCATGCTG -3'

Sequencing Primer
(F):5'- CTACAACAACTCACATTTGGAGTTG -3'
(R):5'- CACCAGCATGCTGAATGTTATGG -3'
Posted On 2022-11-14