Mutagenetix > Incidental Mutation

Incidental Mutation 'R9803:Pkhd1'

735291

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1

Ensembl Gene

ENSMUSG00000043760

Gene Name

polycystic kidney and hepatic disease 1

Synonyms

FPC, tigmin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R9803 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20057779-20618064 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20566849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 379 (V379E)

Ref Sequence

ENSEMBL: ENSMUSP00000085794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088448]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000088448
AA Change: V379E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: V379E

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Blast:IPT	134	254	1e-45	BLAST
IPT	256	353	1.13e-3	SMART
low complexity region	722	743	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC
Pfam:TIG	936	1005	9.1e-8	PFAM
IPT	1016	1101	1.18e-6	SMART
IPT	1105	1190	1.27e0	SMART
IPT	1193	1290	7.05e-5	SMART
IPT	1384	1467	1.36e1	SMART
IPT	1568	1655	2.4e0	SMART
low complexity region	1881	1892	N/A	INTRINSIC
G8	1928	2049	1.15e-48	SMART
low complexity region	2079	2094	N/A	INTRINSIC
PbH1	2244	2266	7.82e3	SMART
PbH1	2287	2321	2.23e3	SMART
PbH1	2404	2426	7.19e2	SMART
PbH1	2459	2481	2.64e2	SMART
low complexity region	2713	2728	N/A	INTRINSIC
G8	2734	2867	1.73e-43	SMART
Blast:G8	2876	2923	2e-17	BLAST
PbH1	3004	3026	3.98e3	SMART
PbH1	3027	3049	1.27e0	SMART
PbH1	3080	3102	5.92e2	SMART
low complexity region	3178	3187	N/A	INTRINSIC
PbH1	3188	3212	8.08e3	SMART
transmembrane domain	3852	3874	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	G	5: 113,703,903 (GRCm38)	S52P	unknown	Het
Ank2	A	G	3: 126,959,077 (GRCm38)	M330T	possibly damaging	Het
Ankar	C	T	1: 72,659,181 (GRCm38)	V905I	possibly damaging	Het
Anln	G	T	9: 22,372,222 (GRCm38)	D438E	probably damaging	Het
C1ql3	T	C	2: 13,004,389 (GRCm38)	N215S	probably damaging	Het
Ccdc110	A	G	8: 45,942,589 (GRCm38)	S506G	probably benign	Het
Ccdc87	A	G	19: 4,841,147 (GRCm38)	T556A	probably benign	Het
Cma1	A	T	14: 55,941,729 (GRCm38)	N236K	probably benign	Het
Csmd2	T	C	4: 128,369,193 (GRCm38)	F724S		Het
Cts8	T	C	13: 61,253,322 (GRCm38)	K130R	possibly damaging	Het
Daam1	A	T	12: 71,944,148 (GRCm38)	T179S	unknown	Het
Fancd2os	T	C	6: 113,597,977 (GRCm38)	T23A	possibly damaging	Het
Gbgt1	T	A	2: 28,504,854 (GRCm38)	I168N	probably damaging	Het
Gckr	G	A	5: 31,300,024 (GRCm38)	G127D	probably damaging	Het
Gm11444	G	A	11: 85,846,873 (GRCm38)	Q164*	probably null	Het
Gm28042	T	A	2: 120,038,503 (GRCm38)	V526E	possibly damaging	Het
Gm8947	T	C	1: 151,192,971 (GRCm38)	V185A	possibly damaging	Het
Hoxd13	C	A	2: 74,668,903 (GRCm38)	H198Q	possibly damaging	Het
Hps6	T	A	19: 46,005,508 (GRCm38)	L628*	probably null	Het
Igha	G	A	12: 113,259,139 (GRCm38)	H221Y		Het
Ighm	A	G	12: 113,419,015 (GRCm38)	S453P		Het
Inpp5f	A	C	7: 128,676,791 (GRCm38)	D435A	possibly damaging	Het
Lfng	A	G	5: 140,607,773 (GRCm38)	T120A	probably damaging	Het
Lrrc4	C	T	6: 28,662,200 (GRCm38)	A172T	probably benign	Het
Lrrc56	A	G	7: 141,207,607 (GRCm38)	T386A	probably benign	Het
Mapkbp1	A	T	2: 120,010,775 (GRCm38)	H81L	probably benign	Het
Mfsd14b	C	A	13: 65,073,600 (GRCm38)	V293L	probably benign	Het
Mrto4	T	A	4: 139,349,070 (GRCm38)	N70I	probably damaging	Het
Mxra8	C	T	4: 155,839,825 (GRCm38)		probably benign	Het
Myo1h	A	G	5: 114,345,936 (GRCm38)	E548G		Het
Ncan	C	T	8: 70,108,101 (GRCm38)	D739N	probably benign	Het
Olfr315	T	C	11: 58,778,769 (GRCm38)	V214A	probably benign	Het
Oxgr1	T	C	14: 120,022,151 (GRCm38)	T215A	possibly damaging	Het
Pcdhgb7	T	A	18: 37,752,035 (GRCm38)	V86E	probably damaging	Het
Pclo	G	A	5: 14,712,615 (GRCm38)	V416M		Het
Phf3	G	T	1: 30,830,791 (GRCm38)	T392K	probably benign	Het
Ppfia3	T	C	7: 45,341,115 (GRCm38)	Y1080C	probably benign	Het
Ptprs	C	A	17: 56,422,217 (GRCm38)	G1254C	probably damaging	Het
Qsox1	A	T	1: 155,782,670 (GRCm38)	D384E	probably benign	Het
Rergl	A	G	6: 139,500,763 (GRCm38)	F23L	probably damaging	Het
Shank1	G	A	7: 44,312,918 (GRCm38)	S71N	unknown	Het
Sidt2	A	G	9: 45,943,614 (GRCm38)	Y588H	probably damaging	Het
Tas2r139	T	A	6: 42,141,132 (GRCm38)	I66K	probably damaging	Het
Tbc1d30	T	A	10: 121,272,075 (GRCm38)	D474V	probably damaging	Het
Tenm4	G	A	7: 96,553,478 (GRCm38)	G100D	probably damaging	Het
Tmem258	G	A	19: 10,207,273 (GRCm38)	V75I	probably benign	Het
Tmem91	G	T	7: 25,670,563 (GRCm38)	H95N	probably damaging	Het
Trps1	T	C	15: 50,846,694 (GRCm38)	K87E	possibly damaging	Het
Tspan11	T	A	6: 127,943,717 (GRCm38)	M209K	probably benign	Het
Tspan17	C	A	13: 54,793,279 (GRCm38)	Q124K	probably benign	Het
Uts2b	G	A	16: 27,360,942 (GRCm38)	R105*	probably null	Het
Vmn2r110	T	A	17: 20,583,468 (GRCm38)	T282S	probably benign	Het
Xdh	T	A	17: 73,922,460 (GRCm38)	M333L	probably benign	Het
Zbtb3	A	G	19: 8,804,469 (GRCm38)	E482G	probably damaging	Het

Other mutations in Pkhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Pkhd1	APN	1	20,566,874 (GRCm38)	critical splice acceptor site	probably null
IGL00687:Pkhd1	APN	1	20,524,070 (GRCm38)	missense	probably benign	0.19
IGL00824:Pkhd1	APN	1	20,081,184 (GRCm38)	critical splice donor site	probably null
IGL00870:Pkhd1	APN	1	20,571,390 (GRCm38)	missense	probably damaging	1.00
IGL00911:Pkhd1	APN	1	20,117,747 (GRCm38)	missense	probably benign	0.00
IGL01015:Pkhd1	APN	1	20,523,258 (GRCm38)	missense	possibly damaging	0.95
IGL01025:Pkhd1	APN	1	20,209,176 (GRCm38)	missense	probably benign	0.04
IGL01064:Pkhd1	APN	1	20,534,530 (GRCm38)	splice site	probably benign
IGL01313:Pkhd1	APN	1	20,201,024 (GRCm38)	missense	probably damaging	1.00
IGL01340:Pkhd1	APN	1	20,522,977 (GRCm38)	missense	probably benign	0.01
IGL01352:Pkhd1	APN	1	20,549,715 (GRCm38)	missense	probably benign	0.34
IGL01456:Pkhd1	APN	1	20,199,459 (GRCm38)	missense	probably damaging	1.00
IGL01530:Pkhd1	APN	1	20,559,419 (GRCm38)	critical splice donor site	probably null
IGL01557:Pkhd1	APN	1	20,116,979 (GRCm38)	missense	possibly damaging	0.59
IGL01655:Pkhd1	APN	1	20,534,633 (GRCm38)	nonsense	probably null
IGL01790:Pkhd1	APN	1	20,558,671 (GRCm38)	missense	probably damaging	0.96
IGL01862:Pkhd1	APN	1	20,358,910 (GRCm38)	missense	probably damaging	1.00
IGL01874:Pkhd1	APN	1	20,103,235 (GRCm38)	missense	probably benign	0.32
IGL01901:Pkhd1	APN	1	20,220,083 (GRCm38)	missense	probably benign	0.11
IGL01903:Pkhd1	APN	1	20,198,137 (GRCm38)	missense	probably damaging	1.00
IGL01981:Pkhd1	APN	1	20,523,567 (GRCm38)	missense	possibly damaging	0.64
IGL02068:Pkhd1	APN	1	20,522,747 (GRCm38)	missense	probably damaging	1.00
IGL02083:Pkhd1	APN	1	20,201,227 (GRCm38)	missense	probably damaging	1.00
IGL02084:Pkhd1	APN	1	20,377,399 (GRCm38)	missense	probably damaging	1.00
IGL02126:Pkhd1	APN	1	20,117,195 (GRCm38)	missense	probably damaging	1.00
IGL02136:Pkhd1	APN	1	20,275,615 (GRCm38)	missense	probably damaging	1.00
IGL02255:Pkhd1	APN	1	20,584,101 (GRCm38)	missense	probably damaging	1.00
IGL02272:Pkhd1	APN	1	20,209,260 (GRCm38)	missense	probably damaging	1.00
IGL02308:Pkhd1	APN	1	20,070,376 (GRCm38)	critical splice donor site	probably null
IGL02364:Pkhd1	APN	1	20,200,783 (GRCm38)	missense	probably benign
IGL02389:Pkhd1	APN	1	20,117,720 (GRCm38)	missense	probably damaging	0.99
IGL02394:Pkhd1	APN	1	20,199,486 (GRCm38)	missense	possibly damaging	0.57
IGL02403:Pkhd1	APN	1	20,562,418 (GRCm38)	missense	probably benign	0.01
IGL02415:Pkhd1	APN	1	20,414,421 (GRCm38)	missense	probably damaging	1.00
IGL02415:Pkhd1	APN	1	20,522,759 (GRCm38)	missense	probably damaging	1.00
IGL02455:Pkhd1	APN	1	20,364,201 (GRCm38)	missense	probably damaging	1.00
IGL02502:Pkhd1	APN	1	20,392,165 (GRCm38)	missense	probably damaging	1.00
IGL02511:Pkhd1	APN	1	20,073,507 (GRCm38)	missense	possibly damaging	0.90
IGL02530:Pkhd1	APN	1	20,117,720 (GRCm38)	missense	probably damaging	0.99
IGL02532:Pkhd1	APN	1	20,117,720 (GRCm38)	missense	probably damaging	0.99
IGL02534:Pkhd1	APN	1	20,117,720 (GRCm38)	missense	probably damaging	0.99
IGL02556:Pkhd1	APN	1	20,310,710 (GRCm38)	missense	probably damaging	1.00
IGL02570:Pkhd1	APN	1	20,520,256 (GRCm38)	missense	probably damaging	0.99
IGL02605:Pkhd1	APN	1	20,550,902 (GRCm38)	missense	possibly damaging	0.66
IGL02641:Pkhd1	APN	1	20,558,752 (GRCm38)	missense	possibly damaging	0.61
IGL02741:Pkhd1	APN	1	20,220,029 (GRCm38)	splice site	probably benign
IGL02752:Pkhd1	APN	1	20,553,591 (GRCm38)	missense	possibly damaging	0.57
IGL02890:Pkhd1	APN	1	20,361,011 (GRCm38)	missense	probably damaging	1.00
IGL02959:Pkhd1	APN	1	20,608,416 (GRCm38)	nonsense	probably null
IGL02960:Pkhd1	APN	1	20,377,446 (GRCm38)	missense	possibly damaging	0.69
IGL02990:Pkhd1	APN	1	20,522,963 (GRCm38)	missense	possibly damaging	0.52
IGL03037:Pkhd1	APN	1	20,522,699 (GRCm38)	missense	probably benign	0.06
IGL03082:Pkhd1	APN	1	20,565,633 (GRCm38)	missense	probably damaging	1.00
IGL03114:Pkhd1	APN	1	20,198,171 (GRCm38)	missense	probably damaging	0.99
IGL03288:Pkhd1	APN	1	20,201,019 (GRCm38)	missense	probably benign	0.01
IGL03328:Pkhd1	APN	1	20,081,300 (GRCm38)	splice site	probably benign
IGL03375:Pkhd1	APN	1	20,117,023 (GRCm38)	missense	probably damaging	1.00
IGL03380:Pkhd1	APN	1	20,200,670 (GRCm38)	missense	probably damaging	1.00
0152:Pkhd1	UTSW	1	20,522,894 (GRCm38)	missense	possibly damaging	0.46
IGL03046:Pkhd1	UTSW	1	20,537,365 (GRCm38)	missense	possibly damaging	0.81
LCD18:Pkhd1	UTSW	1	20,611,414 (GRCm38)	intron	probably benign
P0035:Pkhd1	UTSW	1	20,117,347 (GRCm38)	missense	probably benign	0.00
PIT4260001:Pkhd1	UTSW	1	20,222,906 (GRCm38)	missense	possibly damaging	0.51
R0063:Pkhd1	UTSW	1	20,211,950 (GRCm38)	missense	probably benign	0.02
R0063:Pkhd1	UTSW	1	20,211,950 (GRCm38)	missense	probably benign	0.02
R0071:Pkhd1	UTSW	1	20,201,344 (GRCm38)	missense	probably benign	0.11
R0071:Pkhd1	UTSW	1	20,201,344 (GRCm38)	missense	probably benign	0.11
R0094:Pkhd1	UTSW	1	20,209,246 (GRCm38)	missense	probably damaging	1.00
R0094:Pkhd1	UTSW	1	20,209,246 (GRCm38)	missense	probably damaging	1.00
R0103:Pkhd1	UTSW	1	20,523,359 (GRCm38)	missense	probably benign	0.04
R0103:Pkhd1	UTSW	1	20,523,359 (GRCm38)	missense	probably benign	0.04
R0105:Pkhd1	UTSW	1	20,523,732 (GRCm38)	nonsense	probably null
R0105:Pkhd1	UTSW	1	20,523,732 (GRCm38)	nonsense	probably null
R0115:Pkhd1	UTSW	1	20,350,490 (GRCm38)	missense	probably damaging	1.00
R0193:Pkhd1	UTSW	1	20,358,917 (GRCm38)	missense	probably damaging	1.00
R0245:Pkhd1	UTSW	1	20,540,400 (GRCm38)	missense	probably benign	0.03
R0277:Pkhd1	UTSW	1	20,275,538 (GRCm38)	missense	probably benign	0.04
R0310:Pkhd1	UTSW	1	20,549,822 (GRCm38)	splice site	probably null
R0323:Pkhd1	UTSW	1	20,275,538 (GRCm38)	missense	probably benign	0.04
R0395:Pkhd1	UTSW	1	20,381,547 (GRCm38)	missense	probably benign	0.26
R0412:Pkhd1	UTSW	1	20,117,788 (GRCm38)	missense	probably damaging	1.00
R0506:Pkhd1	UTSW	1	20,559,469 (GRCm38)	missense	probably benign	0.00
R0512:Pkhd1	UTSW	1	20,310,514 (GRCm38)	splice site	probably benign
R0550:Pkhd1	UTSW	1	20,347,223 (GRCm38)	missense	probably null	1.00
R0584:Pkhd1	UTSW	1	20,239,436 (GRCm38)	nonsense	probably null
R0586:Pkhd1	UTSW	1	20,524,111 (GRCm38)	missense	probably benign	0.04
R0598:Pkhd1	UTSW	1	20,200,890 (GRCm38)	missense	probably damaging	1.00
R0603:Pkhd1	UTSW	1	20,117,173 (GRCm38)	missense	probably benign	0.05
R0634:Pkhd1	UTSW	1	20,117,474 (GRCm38)	missense	probably damaging	1.00
R0677:Pkhd1	UTSW	1	20,524,230 (GRCm38)	missense	probably benign	0.01
R0746:Pkhd1	UTSW	1	20,198,107 (GRCm38)	missense	probably damaging	1.00
R0781:Pkhd1	UTSW	1	20,117,484 (GRCm38)	missense	probably benign	0.01
R0840:Pkhd1	UTSW	1	20,350,521 (GRCm38)	missense	probably damaging	0.98
R0946:Pkhd1	UTSW	1	20,199,381 (GRCm38)	missense	probably benign	0.10
R1018:Pkhd1	UTSW	1	20,201,259 (GRCm38)	missense	possibly damaging	0.89
R1028:Pkhd1	UTSW	1	20,117,726 (GRCm38)	missense	probably damaging	1.00
R1136:Pkhd1	UTSW	1	20,522,829 (GRCm38)	missense	possibly damaging	0.68
R1178:Pkhd1	UTSW	1	20,585,157 (GRCm38)	critical splice donor site	probably null
R1180:Pkhd1	UTSW	1	20,585,157 (GRCm38)	critical splice donor site	probably null
R1222:Pkhd1	UTSW	1	20,567,456 (GRCm38)	missense	probably benign	0.07
R1334:Pkhd1	UTSW	1	20,533,905 (GRCm38)	missense	possibly damaging	0.81
R1335:Pkhd1	UTSW	1	20,571,405 (GRCm38)	missense	probably damaging	1.00
R1387:Pkhd1	UTSW	1	20,555,223 (GRCm38)	splice site	probably benign
R1411:Pkhd1	UTSW	1	20,373,896 (GRCm38)	missense	probably damaging	1.00
R1443:Pkhd1	UTSW	1	20,534,558 (GRCm38)	missense	probably damaging	1.00
R1448:Pkhd1	UTSW	1	20,585,157 (GRCm38)	critical splice donor site	probably null
R1468:Pkhd1	UTSW	1	20,523,341 (GRCm38)	missense	probably damaging	1.00
R1468:Pkhd1	UTSW	1	20,523,341 (GRCm38)	missense	probably damaging	1.00
R1473:Pkhd1	UTSW	1	20,522,983 (GRCm38)	missense	probably benign	0.00
R1524:Pkhd1	UTSW	1	20,117,780 (GRCm38)	missense	probably damaging	1.00
R1532:Pkhd1	UTSW	1	20,117,401 (GRCm38)	missense	probably benign	0.08
R1565:Pkhd1	UTSW	1	20,347,457 (GRCm38)	missense	probably damaging	1.00
R1572:Pkhd1	UTSW	1	20,347,440 (GRCm38)	missense	probably benign	0.02
R1583:Pkhd1	UTSW	1	20,117,825 (GRCm38)	missense	probably benign
R1617:Pkhd1	UTSW	1	20,198,050 (GRCm38)	missense	possibly damaging	0.95
R1631:Pkhd1	UTSW	1	20,522,897 (GRCm38)	missense	probably benign	0.06
R1655:Pkhd1	UTSW	1	20,584,129 (GRCm38)	missense	probably damaging	1.00
R1707:Pkhd1	UTSW	1	20,550,840 (GRCm38)	splice site	probably benign
R1753:Pkhd1	UTSW	1	20,533,905 (GRCm38)	missense	possibly damaging	0.81
R1782:Pkhd1	UTSW	1	20,565,711 (GRCm38)	missense	probably damaging	0.98
R1791:Pkhd1	UTSW	1	20,585,152 (GRCm38)	splice site	probably benign
R1822:Pkhd1	UTSW	1	20,347,457 (GRCm38)	missense	probably damaging	1.00
R1823:Pkhd1	UTSW	1	20,347,457 (GRCm38)	missense	probably damaging	1.00
R1824:Pkhd1	UTSW	1	20,347,457 (GRCm38)	missense	probably damaging	1.00
R1836:Pkhd1	UTSW	1	20,117,069 (GRCm38)	missense	probably benign	0.01
R1862:Pkhd1	UTSW	1	20,551,020 (GRCm38)	missense	probably benign	0.00
R1863:Pkhd1	UTSW	1	20,551,020 (GRCm38)	missense	probably benign	0.00
R1869:Pkhd1	UTSW	1	20,615,267 (GRCm38)	critical splice donor site	probably null
R1913:Pkhd1	UTSW	1	20,566,756 (GRCm38)	critical splice donor site	probably null
R1928:Pkhd1	UTSW	1	20,081,300 (GRCm38)	splice site	probably benign
R1969:Pkhd1	UTSW	1	20,381,523 (GRCm38)	missense	probably damaging	1.00
R1970:Pkhd1	UTSW	1	20,381,523 (GRCm38)	missense	probably damaging	1.00
R1981:Pkhd1	UTSW	1	20,117,060 (GRCm38)	missense	probably benign	0.00
R2008:Pkhd1	UTSW	1	20,199,459 (GRCm38)	missense	probably damaging	0.99
R2034:Pkhd1	UTSW	1	20,200,669 (GRCm38)	missense	probably damaging	1.00
R2061:Pkhd1	UTSW	1	20,612,812 (GRCm38)	missense	possibly damaging	0.76
R2062:Pkhd1	UTSW	1	20,201,335 (GRCm38)	missense	probably damaging	0.97
R2108:Pkhd1	UTSW	1	20,553,574 (GRCm38)	nonsense	probably null
R2142:Pkhd1	UTSW	1	20,523,895 (GRCm38)	missense	probably benign	0.00
R2148:Pkhd1	UTSW	1	20,414,220 (GRCm38)	critical splice donor site	probably null
R2176:Pkhd1	UTSW	1	20,553,517 (GRCm38)	missense	probably damaging	1.00
R2202:Pkhd1	UTSW	1	20,537,360 (GRCm38)	missense	probably benign	0.06
R2255:Pkhd1	UTSW	1	20,565,639 (GRCm38)	missense	probably benign	0.23
R2269:Pkhd1	UTSW	1	20,534,535 (GRCm38)	critical splice donor site	probably null
R2275:Pkhd1	UTSW	1	20,200,849 (GRCm38)	missense	possibly damaging	0.95
R2340:Pkhd1	UTSW	1	20,200,855 (GRCm38)	missense	probably damaging	1.00
R2431:Pkhd1	UTSW	1	20,201,165 (GRCm38)	missense	possibly damaging	0.63
R2679:Pkhd1	UTSW	1	20,209,182 (GRCm38)	missense	probably benign	0.03
R2850:Pkhd1	UTSW	1	20,509,076 (GRCm38)	missense	possibly damaging	0.89
R2851:Pkhd1	UTSW	1	20,058,302 (GRCm38)	missense	probably benign	0.16
R2853:Pkhd1	UTSW	1	20,058,302 (GRCm38)	missense	probably benign	0.16
R2984:Pkhd1	UTSW	1	20,222,961 (GRCm38)	missense	possibly damaging	0.84
R2987:Pkhd1	UTSW	1	20,104,599 (GRCm38)	missense	possibly damaging	0.87
R3692:Pkhd1	UTSW	1	20,555,129 (GRCm38)	missense	possibly damaging	0.87
R3721:Pkhd1	UTSW	1	20,585,655 (GRCm38)	missense	probably benign	0.08
R3746:Pkhd1	UTSW	1	20,058,300 (GRCm38)	makesense	probably null
R3838:Pkhd1	UTSW	1	20,534,629 (GRCm38)	missense	possibly damaging	0.66
R3843:Pkhd1	UTSW	1	20,558,723 (GRCm38)	missense	probably benign	0.00
R3861:Pkhd1	UTSW	1	20,200,927 (GRCm38)	missense	probably damaging	1.00
R3893:Pkhd1	UTSW	1	20,312,138 (GRCm38)	nonsense	probably null
R3926:Pkhd1	UTSW	1	20,550,873 (GRCm38)	missense	probably benign	0.00
R4183:Pkhd1	UTSW	1	20,117,807 (GRCm38)	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20,563,686 (GRCm38)	missense	probably benign	0.06
R4184:Pkhd1	UTSW	1	20,209,277 (GRCm38)	missense	probably benign	0.03
R4255:Pkhd1	UTSW	1	20,593,934 (GRCm38)	missense	probably damaging	0.99
R4275:Pkhd1	UTSW	1	20,058,384 (GRCm38)	missense	probably benign	0.00
R4342:Pkhd1	UTSW	1	20,058,617 (GRCm38)	missense	probably benign	0.00
R4386:Pkhd1	UTSW	1	20,414,292 (GRCm38)	missense	probably benign	0.00
R4402:Pkhd1	UTSW	1	20,239,411 (GRCm38)	missense	probably damaging	1.00
R4431:Pkhd1	UTSW	1	20,523,314 (GRCm38)	missense	probably damaging	0.99
R4560:Pkhd1	UTSW	1	20,211,858 (GRCm38)	missense	probably damaging	1.00
R4561:Pkhd1	UTSW	1	20,534,719 (GRCm38)	missense	possibly damaging	0.89
R4570:Pkhd1	UTSW	1	20,381,523 (GRCm38)	missense	probably damaging	1.00
R4571:Pkhd1	UTSW	1	20,613,409 (GRCm38)	missense	probably damaging	1.00
R4588:Pkhd1	UTSW	1	20,200,868 (GRCm38)	missense	probably benign	0.00
R4598:Pkhd1	UTSW	1	20,503,056 (GRCm38)	missense	probably damaging	1.00
R4651:Pkhd1	UTSW	1	20,381,523 (GRCm38)	missense	probably damaging	1.00
R4657:Pkhd1	UTSW	1	20,364,167 (GRCm38)	missense	possibly damaging	0.89
R4718:Pkhd1	UTSW	1	20,081,228 (GRCm38)	missense	probably damaging	1.00
R4740:Pkhd1	UTSW	1	20,524,130 (GRCm38)	missense	probably benign
R4750:Pkhd1	UTSW	1	20,524,112 (GRCm38)	missense	possibly damaging	0.57
R4816:Pkhd1	UTSW	1	20,199,415 (GRCm38)	missense	probably damaging	0.99
R4825:Pkhd1	UTSW	1	20,537,401 (GRCm38)	missense	probably damaging	0.96
R4885:Pkhd1	UTSW	1	20,070,488 (GRCm38)	missense	possibly damaging	0.55
R4907:Pkhd1	UTSW	1	20,209,226 (GRCm38)	missense	probably damaging	1.00
R4944:Pkhd1	UTSW	1	20,288,205 (GRCm38)	missense	probably null	0.01
R5062:Pkhd1	UTSW	1	20,585,711 (GRCm38)	missense	probably benign	0.00
R5090:Pkhd1	UTSW	1	20,200,757 (GRCm38)	missense	probably damaging	1.00
R5104:Pkhd1	UTSW	1	20,585,191 (GRCm38)	missense	probably damaging	1.00
R5187:Pkhd1	UTSW	1	20,209,224 (GRCm38)	missense	possibly damaging	0.67
R5202:Pkhd1	UTSW	1	20,547,341 (GRCm38)	missense	probably benign	0.01
R5240:Pkhd1	UTSW	1	20,275,641 (GRCm38)	missense	probably benign	0.04
R5248:Pkhd1	UTSW	1	20,534,545 (GRCm38)	missense	probably benign	0.00
R5252:Pkhd1	UTSW	1	20,350,411 (GRCm38)	critical splice donor site	probably null
R5293:Pkhd1	UTSW	1	20,509,076 (GRCm38)	missense	possibly damaging	0.89
R5311:Pkhd1	UTSW	1	20,565,870 (GRCm38)	missense	possibly damaging	0.94
R5317:Pkhd1	UTSW	1	20,450,304 (GRCm38)	missense	probably damaging	1.00
R5346:Pkhd1	UTSW	1	20,523,434 (GRCm38)	missense	probably damaging	0.96
R5346:Pkhd1	UTSW	1	20,392,097 (GRCm38)	missense	probably benign
R5431:Pkhd1	UTSW	1	20,117,836 (GRCm38)	missense	probably benign	0.25
R5447:Pkhd1	UTSW	1	20,239,385 (GRCm38)	missense	probably benign	0.00
R5478:Pkhd1	UTSW	1	20,201,156 (GRCm38)	missense	probably damaging	1.00
R5497:Pkhd1	UTSW	1	20,377,404 (GRCm38)	missense	possibly damaging	0.94
R5554:Pkhd1	UTSW	1	20,081,252 (GRCm38)	missense	probably damaging	0.99
R5579:Pkhd1	UTSW	1	20,523,142 (GRCm38)	missense	probably damaging	0.96
R5614:Pkhd1	UTSW	1	20,073,526 (GRCm38)	missense	possibly damaging	0.83
R5648:Pkhd1	UTSW	1	20,558,626 (GRCm38)	missense	probably benign	0.04
R5651:Pkhd1	UTSW	1	20,117,807 (GRCm38)	missense	probably benign	0.03
R5665:Pkhd1	UTSW	1	20,588,531 (GRCm38)	missense	probably damaging	1.00
R5681:Pkhd1	UTSW	1	20,547,461 (GRCm38)	missense	possibly damaging	0.61
R5754:Pkhd1	UTSW	1	20,523,651 (GRCm38)	nonsense	probably null
R5760:Pkhd1	UTSW	1	20,073,554 (GRCm38)	missense	probably benign	0.02
R5776:Pkhd1	UTSW	1	20,209,185 (GRCm38)	missense	possibly damaging	0.62
R5782:Pkhd1	UTSW	1	20,058,600 (GRCm38)	missense	probably benign
R5810:Pkhd1	UTSW	1	20,200,673 (GRCm38)	missense	probably benign	0.26
R5814:Pkhd1	UTSW	1	20,199,405 (GRCm38)	missense	probably damaging	1.00
R5816:Pkhd1	UTSW	1	20,058,678 (GRCm38)	missense	probably benign	0.03
R5835:Pkhd1	UTSW	1	20,201,083 (GRCm38)	missense	probably benign	0.01
R5844:Pkhd1	UTSW	1	20,381,461 (GRCm38)	missense	probably benign	0.00
R5847:Pkhd1	UTSW	1	20,374,736 (GRCm38)	nonsense	probably null
R5852:Pkhd1	UTSW	1	20,377,408 (GRCm38)	missense	probably benign	0.22
R5863:Pkhd1	UTSW	1	20,520,210 (GRCm38)	missense	possibly damaging	0.63
R6213:Pkhd1	UTSW	1	20,523,770 (GRCm38)	missense	possibly damaging	0.80
R6351:Pkhd1	UTSW	1	20,211,951 (GRCm38)	missense	probably benign	0.00
R6386:Pkhd1	UTSW	1	20,551,020 (GRCm38)	missense	probably damaging	0.96
R6542:Pkhd1	UTSW	1	20,585,703 (GRCm38)	missense	probably benign	0.02
R6579:Pkhd1	UTSW	1	20,200,823 (GRCm38)	missense	probably benign	0.01
R6658:Pkhd1	UTSW	1	20,612,705 (GRCm38)	missense	probably damaging	1.00
R6765:Pkhd1	UTSW	1	20,058,339 (GRCm38)	missense	probably benign
R6886:Pkhd1	UTSW	1	20,347,280 (GRCm38)	missense	probably benign	0.01
R6892:Pkhd1	UTSW	1	20,523,515 (GRCm38)	missense	probably damaging	1.00
R6900:Pkhd1	UTSW	1	20,534,701 (GRCm38)	missense	probably benign	0.06
R6932:Pkhd1	UTSW	1	20,562,451 (GRCm38)	missense	probably benign	0.19
R7191:Pkhd1	UTSW	1	20,558,719 (GRCm38)	missense	probably benign	0.00
R7220:Pkhd1	UTSW	1	20,523,126 (GRCm38)	missense	possibly damaging	0.89
R7329:Pkhd1	UTSW	1	20,547,519 (GRCm38)	missense	probably damaging	0.96
R7361:Pkhd1	UTSW	1	20,593,953 (GRCm38)	missense	probably damaging	1.00
R7381:Pkhd1	UTSW	1	20,200,973 (GRCm38)	missense	probably damaging	1.00
R7388:Pkhd1	UTSW	1	20,239,304 (GRCm38)	missense	not run
R7436:Pkhd1	UTSW	1	20,200,701 (GRCm38)	missense	probably benign
R7473:Pkhd1	UTSW	1	20,549,756 (GRCm38)	missense	probably damaging	0.99
R7578:Pkhd1	UTSW	1	20,347,361 (GRCm38)	missense	probably damaging	1.00
R7751:Pkhd1	UTSW	1	20,200,925 (GRCm38)	missense	probably damaging	1.00
R7755:Pkhd1	UTSW	1	20,547,493 (GRCm38)	missense	probably damaging	0.98
R7757:Pkhd1	UTSW	1	20,562,415 (GRCm38)	missense	probably damaging	1.00
R7832:Pkhd1	UTSW	1	20,502,999 (GRCm38)	missense	probably damaging	1.00
R7834:Pkhd1	UTSW	1	20,312,049 (GRCm38)	missense	probably benign
R7920:Pkhd1	UTSW	1	20,275,535 (GRCm38)	missense	probably damaging	1.00
R8014:Pkhd1	UTSW	1	20,508,891 (GRCm38)	critical splice donor site	probably null
R8034:Pkhd1	UTSW	1	20,381,438 (GRCm38)	missense	possibly damaging	0.94
R8085:Pkhd1	UTSW	1	20,613,415 (GRCm38)	missense	probably damaging	1.00
R8087:Pkhd1	UTSW	1	20,523,089 (GRCm38)	missense	probably damaging	1.00
R8103:Pkhd1	UTSW	1	20,200,757 (GRCm38)	missense	probably damaging	1.00
R8122:Pkhd1	UTSW	1	20,562,458 (GRCm38)	missense	probably damaging	1.00
R8273:Pkhd1	UTSW	1	20,537,420 (GRCm38)	splice site	probably benign
R8485:Pkhd1	UTSW	1	20,523,033 (GRCm38)	missense	probably damaging	1.00
R8504:Pkhd1	UTSW	1	20,520,208 (GRCm38)	missense	probably benign	0.10
R8544:Pkhd1	UTSW	1	20,522,975 (GRCm38)	missense	probably damaging	1.00
R8692:Pkhd1	UTSW	1	20,392,150 (GRCm38)	missense	probably damaging	1.00
R8787:Pkhd1	UTSW	1	20,288,237 (GRCm38)	missense	probably damaging	0.99
R8853:Pkhd1	UTSW	1	20,073,455 (GRCm38)	critical splice donor site	probably null
R8907:Pkhd1	UTSW	1	20,117,561 (GRCm38)	missense	possibly damaging	0.88
R8934:Pkhd1	UTSW	1	20,392,010 (GRCm38)	critical splice donor site	probably null
R8990:Pkhd1	UTSW	1	20,347,305 (GRCm38)	missense	probably benign	0.00
R8998:Pkhd1	UTSW	1	20,364,201 (GRCm38)	missense	probably damaging	1.00
R9024:Pkhd1	UTSW	1	20,522,751 (GRCm38)	missense	probably benign	0.24
R9035:Pkhd1	UTSW	1	20,502,952 (GRCm38)	missense	probably damaging	1.00
R9092:Pkhd1	UTSW	1	20,562,362 (GRCm38)	missense	probably benign	0.00
R9238:Pkhd1	UTSW	1	20,534,575 (GRCm38)	missense	possibly damaging	0.89
R9258:Pkhd1	UTSW	1	20,373,950 (GRCm38)	missense	probably damaging	0.99
R9262:Pkhd1	UTSW	1	20,548,127 (GRCm38)	missense	probably benign	0.01
R9297:Pkhd1	UTSW	1	20,222,894 (GRCm38)	missense	probably benign	0.06
R9452:Pkhd1	UTSW	1	20,612,729 (GRCm38)	missense	possibly damaging	0.77
R9515:Pkhd1	UTSW	1	20,567,517 (GRCm38)	missense	probably damaging	1.00
R9540:Pkhd1	UTSW	1	20,199,346 (GRCm38)	missense	probably benign	0.00
R9542:Pkhd1	UTSW	1	20,117,780 (GRCm38)	missense	probably damaging	1.00
R9629:Pkhd1	UTSW	1	20,392,213 (GRCm38)	missense	possibly damaging	0.63
R9644:Pkhd1	UTSW	1	20,547,466 (GRCm38)	missense	probably benign	0.04
R9739:Pkhd1	UTSW	1	20,350,484 (GRCm38)	missense	probably damaging	1.00
R9767:Pkhd1	UTSW	1	20,414,412 (GRCm38)	missense	probably benign
R9781:Pkhd1	UTSW	1	20,117,441 (GRCm38)	missense	possibly damaging	0.95
X0012:Pkhd1	UTSW	1	20,373,926 (GRCm38)	missense	probably damaging	1.00
X0067:Pkhd1	UTSW	1	20,520,226 (GRCm38)	missense	probably damaging	1.00
Z1176:Pkhd1	UTSW	1	20,523,747 (GRCm38)	missense	possibly damaging	0.81
Z1177:Pkhd1	UTSW	1	20,523,621 (GRCm38)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,310,594 (GRCm38)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,117,883 (GRCm38)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,551,019 (GRCm38)	missense	probably benign
Z1177:Pkhd1	UTSW	1	20,523,938 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCATAGGACAGAAGAGCTTTACC -3'
(R):5'- CTCAGGAGACTAGACAGGTGTG -3'

Sequencing Primer
(F):5'- GGACAGAAGAGCTTTACCTTTGATCC -3'
(R):5'- AGGCCTTGCTTAGTCTCA -3'

Posted On

2022-11-14