Incidental Mutation 'R9803:Phf3'
ID 735292
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene Name PHD finger protein 3
Synonyms AU020177, 2310061N19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 30841417-30912989 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30869872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 392 (T392K)
Ref Sequence ENSEMBL: ENSMUSP00000085650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000188780] [ENSMUST00000191064]
AlphaFold B2RQG2
Predicted Effect probably benign
Transcript: ENSMUST00000088310
AA Change: T392K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: T392K

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186733
AA Change: T392K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: T392K

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188780
SMART Domains Protein: ENSMUSP00000140935
Gene: ENSMUSG00000048874

DomainStartEndE-ValueType
low complexity region 158 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191064
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30,850,928 (GRCm39) missense probably damaging 0.99
IGL00704:Phf3 APN 1 30,843,919 (GRCm39) missense probably benign
IGL01147:Phf3 APN 1 30,843,250 (GRCm39) missense probably damaging 1.00
IGL01360:Phf3 APN 1 30,847,809 (GRCm39) missense probably damaging 1.00
IGL01376:Phf3 APN 1 30,869,566 (GRCm39) missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30,843,386 (GRCm39) nonsense probably null
IGL01830:Phf3 APN 1 30,853,148 (GRCm39) nonsense probably null
IGL02108:Phf3 APN 1 30,869,032 (GRCm39) missense probably damaging 1.00
IGL02156:Phf3 APN 1 30,847,859 (GRCm39) missense probably damaging 1.00
IGL02576:Phf3 APN 1 30,869,117 (GRCm39) missense probably benign 0.01
IGL03031:Phf3 APN 1 30,843,734 (GRCm39) missense probably benign 0.00
IGL03334:Phf3 APN 1 30,844,810 (GRCm39) missense probably damaging 0.99
IGL03411:Phf3 APN 1 30,843,482 (GRCm39) missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30,844,104 (GRCm39) utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30,855,622 (GRCm39) missense probably damaging 1.00
R0037:Phf3 UTSW 1 30,843,999 (GRCm39) missense probably benign 0.03
R0052:Phf3 UTSW 1 30,847,848 (GRCm39) missense probably damaging 1.00
R0114:Phf3 UTSW 1 30,844,524 (GRCm39) missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30,844,146 (GRCm39) missense probably benign 0.01
R0225:Phf3 UTSW 1 30,844,146 (GRCm39) missense probably benign 0.01
R0715:Phf3 UTSW 1 30,850,919 (GRCm39) missense probably damaging 1.00
R0835:Phf3 UTSW 1 30,869,632 (GRCm39) missense probably benign 0.02
R0848:Phf3 UTSW 1 30,902,253 (GRCm39) missense probably damaging 1.00
R1473:Phf3 UTSW 1 30,845,021 (GRCm39) missense probably damaging 1.00
R1522:Phf3 UTSW 1 30,844,729 (GRCm39) missense probably benign 0.05
R1549:Phf3 UTSW 1 30,843,923 (GRCm39) missense probably benign 0.00
R1555:Phf3 UTSW 1 30,844,958 (GRCm39) missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30,851,023 (GRCm39) missense probably damaging 1.00
R1789:Phf3 UTSW 1 30,845,287 (GRCm39) missense probably damaging 1.00
R1875:Phf3 UTSW 1 30,869,704 (GRCm39) missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30,843,426 (GRCm39) missense probably damaging 1.00
R1957:Phf3 UTSW 1 30,870,601 (GRCm39) missense probably damaging 1.00
R2019:Phf3 UTSW 1 30,850,928 (GRCm39) missense probably damaging 0.99
R2259:Phf3 UTSW 1 30,843,424 (GRCm39) missense probably benign 0.20
R2305:Phf3 UTSW 1 30,844,556 (GRCm39) nonsense probably null
R2345:Phf3 UTSW 1 30,844,432 (GRCm39) nonsense probably null
R2424:Phf3 UTSW 1 30,845,430 (GRCm39) missense probably damaging 1.00
R2497:Phf3 UTSW 1 30,869,095 (GRCm39) missense probably damaging 1.00
R2504:Phf3 UTSW 1 30,849,870 (GRCm39) missense probably damaging 1.00
R3522:Phf3 UTSW 1 30,844,684 (GRCm39) missense probably damaging 1.00
R3816:Phf3 UTSW 1 30,844,834 (GRCm39) missense probably damaging 1.00
R4152:Phf3 UTSW 1 30,870,539 (GRCm39) missense probably benign 0.13
R4403:Phf3 UTSW 1 30,843,490 (GRCm39) missense probably damaging 1.00
R4658:Phf3 UTSW 1 30,902,169 (GRCm39) missense probably damaging 1.00
R4663:Phf3 UTSW 1 30,860,296 (GRCm39) missense probably damaging 1.00
R4669:Phf3 UTSW 1 30,869,027 (GRCm39) missense probably damaging 1.00
R4706:Phf3 UTSW 1 30,844,687 (GRCm39) missense probably damaging 1.00
R4757:Phf3 UTSW 1 30,859,908 (GRCm39) missense probably damaging 1.00
R4766:Phf3 UTSW 1 30,853,020 (GRCm39) unclassified probably benign
R4786:Phf3 UTSW 1 30,855,638 (GRCm39) nonsense probably null
R5107:Phf3 UTSW 1 30,870,566 (GRCm39) missense probably benign 0.03
R5155:Phf3 UTSW 1 30,863,457 (GRCm39) missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30,842,887 (GRCm39) missense probably damaging 1.00
R5823:Phf3 UTSW 1 30,843,764 (GRCm39) missense probably damaging 1.00
R5944:Phf3 UTSW 1 30,859,785 (GRCm39) missense probably damaging 1.00
R5979:Phf3 UTSW 1 30,844,827 (GRCm39) missense probably damaging 1.00
R6007:Phf3 UTSW 1 30,843,426 (GRCm39) missense probably damaging 1.00
R6024:Phf3 UTSW 1 30,902,307 (GRCm39) missense probably damaging 1.00
R6072:Phf3 UTSW 1 30,869,769 (GRCm39) missense probably benign 0.08
R6533:Phf3 UTSW 1 30,845,399 (GRCm39) missense probably damaging 1.00
R6649:Phf3 UTSW 1 30,844,104 (GRCm39) missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30,844,104 (GRCm39) missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30,843,711 (GRCm39) missense probably damaging 0.97
R6855:Phf3 UTSW 1 30,859,204 (GRCm39) missense probably damaging 1.00
R6862:Phf3 UTSW 1 30,853,063 (GRCm39) missense probably damaging 1.00
R6930:Phf3 UTSW 1 30,850,958 (GRCm39) missense probably damaging 1.00
R7135:Phf3 UTSW 1 30,870,190 (GRCm39) missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30,852,211 (GRCm39) missense probably benign 0.01
R7352:Phf3 UTSW 1 30,843,407 (GRCm39) missense possibly damaging 0.87
R7455:Phf3 UTSW 1 30,876,239 (GRCm39) missense probably damaging 0.96
R7549:Phf3 UTSW 1 30,870,556 (GRCm39) missense probably benign 0.01
R7609:Phf3 UTSW 1 30,844,582 (GRCm39) missense probably benign 0.05
R7720:Phf3 UTSW 1 30,868,938 (GRCm39) missense probably damaging 1.00
R7745:Phf3 UTSW 1 30,843,305 (GRCm39) missense probably damaging 1.00
R8134:Phf3 UTSW 1 30,863,552 (GRCm39) missense unknown
R8264:Phf3 UTSW 1 30,870,138 (GRCm39) missense possibly damaging 0.48
R8545:Phf3 UTSW 1 30,863,391 (GRCm39) missense possibly damaging 0.48
R8821:Phf3 UTSW 1 30,860,347 (GRCm39) nonsense probably null
R8831:Phf3 UTSW 1 30,860,347 (GRCm39) nonsense probably null
R8873:Phf3 UTSW 1 30,843,773 (GRCm39) missense possibly damaging 0.74
R9101:Phf3 UTSW 1 30,843,026 (GRCm39) missense possibly damaging 0.56
R9402:Phf3 UTSW 1 30,850,928 (GRCm39) missense probably damaging 0.99
R9426:Phf3 UTSW 1 30,870,625 (GRCm39) nonsense probably null
R9594:Phf3 UTSW 1 30,869,003 (GRCm39) missense probably benign 0.07
R9707:Phf3 UTSW 1 30,868,923 (GRCm39) critical splice donor site probably null
Z1177:Phf3 UTSW 1 30,851,049 (GRCm39) critical splice acceptor site probably null
Z1177:Phf3 UTSW 1 30,844,132 (GRCm39) missense unknown
Z1177:Phf3 UTSW 1 30,843,376 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTATCATCCTGAAGATTGGCTG -3'
(R):5'- AGTTTCCCTGCGAAGGTGAC -3'

Sequencing Primer
(F):5'- ATCCTGAAGATTGGCTGTTTCC -3'
(R):5'- GCCGAGGAACCCGAATCTTC -3'
Posted On 2022-11-14