Mutagenetix > Incidental Mutation

Incidental Mutation 'R9803:Phf3'

735292

Institutional Source

Beutler Lab

Gene Symbol

Phf3

Ensembl Gene

ENSMUSG00000048874

Gene Name

PHD finger protein 3

Synonyms

AU020177, 2310061N19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9803 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30802339-30873921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 30830791 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 392 (T392K)

Ref Sequence

ENSEMBL: ENSMUSP00000085650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000188780] [ENSMUST00000191064]

AlphaFold

B2RQG2

Predicted Effect

probably benign
Transcript: ENSMUST00000088310
AA Change: T392K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: T392K

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186733
AA Change: T392K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: T392K

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188780

SMART Domains

Protein: ENSMUSP00000140935
Gene: ENSMUSG00000048874

Domain	Start	End	E-Value	Type
low complexity region	158	169	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191064

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	G	5: 113,703,903	S52P	unknown	Het
Ank2	A	G	3: 126,959,077	M330T	possibly damaging	Het
Ankar	C	T	1: 72,659,181	V905I	possibly damaging	Het
Anln	G	T	9: 22,372,222	D438E	probably damaging	Het
C1ql3	T	C	2: 13,004,389	N215S	probably damaging	Het
Ccdc110	A	G	8: 45,942,589	S506G	probably benign	Het
Ccdc87	A	G	19: 4,841,147	T556A	probably benign	Het
Cma1	A	T	14: 55,941,729	N236K	probably benign	Het
Csmd2	T	C	4: 128,369,193	F724S		Het
Cts8	T	C	13: 61,253,322	K130R	possibly damaging	Het
Daam1	A	T	12: 71,944,148	T179S	unknown	Het
Fancd2os	T	C	6: 113,597,977	T23A	possibly damaging	Het
Gbgt1	T	A	2: 28,504,854	I168N	probably damaging	Het
Gckr	G	A	5: 31,300,024	G127D	probably damaging	Het
Gm11444	G	A	11: 85,846,873	Q164*	probably null	Het
Gm28042	T	A	2: 120,038,503	V526E	possibly damaging	Het
Gm8947	T	C	1: 151,192,971	V185A	possibly damaging	Het
Hoxd13	C	A	2: 74,668,903	H198Q	possibly damaging	Het
Hps6	T	A	19: 46,005,508	L628*	probably null	Het
Igha	G	A	12: 113,259,139	H221Y		Het
Ighm	A	G	12: 113,419,015	S453P		Het
Inpp5f	A	C	7: 128,676,791	D435A	possibly damaging	Het
Lfng	A	G	5: 140,607,773	T120A	probably damaging	Het
Lrrc4	C	T	6: 28,662,200	A172T	probably benign	Het
Lrrc56	A	G	7: 141,207,607	T386A	probably benign	Het
Mapkbp1	A	T	2: 120,010,775	H81L	probably benign	Het
Mfsd14b	C	A	13: 65,073,600	V293L	probably benign	Het
Mrto4	T	A	4: 139,349,070	N70I	probably damaging	Het
Mxra8	C	T	4: 155,839,825		probably benign	Het
Myo1h	A	G	5: 114,345,936	E548G		Het
Ncan	C	T	8: 70,108,101	D739N	probably benign	Het
Olfr315	T	C	11: 58,778,769	V214A	probably benign	Het
Oxgr1	T	C	14: 120,022,151	T215A	possibly damaging	Het
Pcdhgb7	T	A	18: 37,752,035	V86E	probably damaging	Het
Pclo	G	A	5: 14,712,615	V416M		Het
Pkhd1	A	T	1: 20,566,849	V379E	probably damaging	Het
Ppfia3	T	C	7: 45,341,115	Y1080C	probably benign	Het
Ptprs	C	A	17: 56,422,217	G1254C	probably damaging	Het
Qsox1	A	T	1: 155,782,670	D384E	probably benign	Het
Rergl	A	G	6: 139,500,763	F23L	probably damaging	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Sidt2	A	G	9: 45,943,614	Y588H	probably damaging	Het
Tas2r139	T	A	6: 42,141,132	I66K	probably damaging	Het
Tbc1d30	T	A	10: 121,272,075	D474V	probably damaging	Het
Tenm4	G	A	7: 96,553,478	G100D	probably damaging	Het
Tmem258	G	A	19: 10,207,273	V75I	probably benign	Het
Tmem91	G	T	7: 25,670,563	H95N	probably damaging	Het
Trps1	T	C	15: 50,846,694	K87E	possibly damaging	Het
Tspan11	T	A	6: 127,943,717	M209K	probably benign	Het
Tspan17	C	A	13: 54,793,279	Q124K	probably benign	Het
Uts2b	G	A	16: 27,360,942	R105*	probably null	Het
Vmn2r110	T	A	17: 20,583,468	T282S	probably benign	Het
Xdh	T	A	17: 73,922,460	M333L	probably benign	Het
Zbtb3	A	G	19: 8,804,469	E482G	probably damaging	Het

Other mutations in Phf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Phf3	APN	1	30811847	missense	probably damaging	0.99
IGL00704:Phf3	APN	1	30804838	missense	probably benign
IGL01147:Phf3	APN	1	30804169	missense	probably damaging	1.00
IGL01360:Phf3	APN	1	30808728	missense	probably damaging	1.00
IGL01376:Phf3	APN	1	30830485	missense	possibly damaging	0.62
IGL01396:Phf3	APN	1	30804305	nonsense	probably null
IGL01830:Phf3	APN	1	30814067	nonsense	probably null
IGL02108:Phf3	APN	1	30829951	missense	probably damaging	1.00
IGL02156:Phf3	APN	1	30808778	missense	probably damaging	1.00
IGL02576:Phf3	APN	1	30830036	missense	probably benign	0.01
IGL03031:Phf3	APN	1	30804653	missense	probably benign	0.00
IGL03334:Phf3	APN	1	30805729	missense	probably damaging	0.99
IGL03411:Phf3	APN	1	30804401	missense	probably damaging	1.00
FR4976:Phf3	UTSW	1	30805023	utr 3 prime	probably benign
PIT4458001:Phf3	UTSW	1	30816541	missense	probably damaging	1.00
R0037:Phf3	UTSW	1	30804918	missense	probably benign	0.03
R0052:Phf3	UTSW	1	30808767	missense	probably damaging	1.00
R0114:Phf3	UTSW	1	30805443	missense	possibly damaging	0.87
R0123:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0225:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0715:Phf3	UTSW	1	30811838	missense	probably damaging	1.00
R0835:Phf3	UTSW	1	30830551	missense	probably benign	0.02
R0848:Phf3	UTSW	1	30863172	missense	probably damaging	1.00
R1473:Phf3	UTSW	1	30805940	missense	probably damaging	1.00
R1522:Phf3	UTSW	1	30805648	missense	probably benign	0.05
R1549:Phf3	UTSW	1	30804842	missense	probably benign	0.00
R1555:Phf3	UTSW	1	30805877	missense	possibly damaging	0.86
R1780:Phf3	UTSW	1	30811942	missense	probably damaging	1.00
R1789:Phf3	UTSW	1	30806206	missense	probably damaging	1.00
R1875:Phf3	UTSW	1	30830623	missense	possibly damaging	0.81
R1912:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R1957:Phf3	UTSW	1	30831520	missense	probably damaging	1.00
R2019:Phf3	UTSW	1	30811847	missense	probably damaging	0.99
R2259:Phf3	UTSW	1	30804343	missense	probably benign	0.20
R2305:Phf3	UTSW	1	30805475	nonsense	probably null
R2345:Phf3	UTSW	1	30805351	nonsense	probably null
R2424:Phf3	UTSW	1	30806349	missense	probably damaging	1.00
R2497:Phf3	UTSW	1	30830014	missense	probably damaging	1.00
R2504:Phf3	UTSW	1	30810789	missense	probably damaging	1.00
R3522:Phf3	UTSW	1	30805603	missense	probably damaging	1.00
R3816:Phf3	UTSW	1	30805753	missense	probably damaging	1.00
R4152:Phf3	UTSW	1	30831458	missense	probably benign	0.13
R4403:Phf3	UTSW	1	30804409	missense	probably damaging	1.00
R4658:Phf3	UTSW	1	30863088	missense	probably damaging	1.00
R4663:Phf3	UTSW	1	30821215	missense	probably damaging	1.00
R4669:Phf3	UTSW	1	30829946	missense	probably damaging	1.00
R4706:Phf3	UTSW	1	30805606	missense	probably damaging	1.00
R4757:Phf3	UTSW	1	30820827	missense	probably damaging	1.00
R4766:Phf3	UTSW	1	30813939	unclassified	probably benign
R4786:Phf3	UTSW	1	30816557	nonsense	probably null
R5107:Phf3	UTSW	1	30831485	missense	probably benign	0.03
R5155:Phf3	UTSW	1	30824376	missense	possibly damaging	0.87
R5310:Phf3	UTSW	1	30803806	missense	probably damaging	1.00
R5823:Phf3	UTSW	1	30804683	missense	probably damaging	1.00
R5944:Phf3	UTSW	1	30820704	missense	probably damaging	1.00
R5979:Phf3	UTSW	1	30805746	missense	probably damaging	1.00
R6007:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R6024:Phf3	UTSW	1	30863226	missense	probably damaging	1.00
R6072:Phf3	UTSW	1	30830688	missense	probably benign	0.08
R6533:Phf3	UTSW	1	30806318	missense	probably damaging	1.00
R6649:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6653:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6852:Phf3	UTSW	1	30804630	missense	probably damaging	0.97
R6855:Phf3	UTSW	1	30820123	missense	probably damaging	1.00
R6862:Phf3	UTSW	1	30813982	missense	probably damaging	1.00
R6930:Phf3	UTSW	1	30811877	missense	probably damaging	1.00
R7135:Phf3	UTSW	1	30831109	missense	possibly damaging	0.61
R7323:Phf3	UTSW	1	30813130	missense	probably benign	0.01
R7352:Phf3	UTSW	1	30804326	missense	possibly damaging	0.87
R7455:Phf3	UTSW	1	30837158	missense	probably damaging	0.96
R7549:Phf3	UTSW	1	30831475	missense	probably benign	0.01
R7609:Phf3	UTSW	1	30805501	missense	probably benign	0.05
R7720:Phf3	UTSW	1	30829857	missense	probably damaging	1.00
R7745:Phf3	UTSW	1	30804224	missense	probably damaging	1.00
R8134:Phf3	UTSW	1	30824471	missense	unknown
R8264:Phf3	UTSW	1	30831057	missense	possibly damaging	0.48
R8545:Phf3	UTSW	1	30824310	missense	possibly damaging	0.48
R8821:Phf3	UTSW	1	30821266	nonsense	probably null
R8831:Phf3	UTSW	1	30821266	nonsense	probably null
R8873:Phf3	UTSW	1	30804692	missense	possibly damaging	0.74
R9101:Phf3	UTSW	1	30803945	missense	possibly damaging	0.56
R9402:Phf3	UTSW	1	30811847	missense	probably damaging	0.99
R9426:Phf3	UTSW	1	30831544	nonsense	probably null
R9594:Phf3	UTSW	1	30829922	missense	probably benign	0.07
R9707:Phf3	UTSW	1	30829842	critical splice donor site	probably null
Z1177:Phf3	UTSW	1	30804295	missense	probably damaging	1.00
Z1177:Phf3	UTSW	1	30805051	missense	unknown
Z1177:Phf3	UTSW	1	30811968	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCTATCATCCTGAAGATTGGCTG -3'
(R):5'- AGTTTCCCTGCGAAGGTGAC -3'

Sequencing Primer
(F):5'- ATCCTGAAGATTGGCTGTTTCC -3'
(R):5'- GCCGAGGAACCCGAATCTTC -3'

Posted On

2022-11-14