Incidental Mutation 'R9803:Qsox1'
ID 735295
Institutional Source Beutler Lab
Gene Symbol Qsox1
Ensembl Gene ENSMUSG00000033684
Gene Name quiescin Q6 sulfhydryl oxidase 1
Synonyms Qscn6, b2b2673Clo, QSOX, 1300003H02Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.675) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 155653901-155688645 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 155658416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 384 (D384E)
Ref Sequence ENSEMBL: ENSMUSP00000035658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035325] [ENSMUST00000111764] [ENSMUST00000194632]
AlphaFold Q8BND5
PDB Structure C76A/C455S mutant of mouse QSOX1 containing an interdomain disulfide [X-RAY DIFFRACTION]
C76A/C455S mutant of mouse QSOX1 containing an interdomain disulfide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035325
AA Change: D384E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035658
Gene: ENSMUSG00000033684
AA Change: D384E

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 46 149 9e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 507 7e-29 PFAM
low complexity region 679 692 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111764
AA Change: D384E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107394
Gene: ENSMUSG00000033684
AA Change: D384E

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 45 149 1.7e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 508 1.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194632
AA Change: D384E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142301
Gene: ENSMUSG00000033684
AA Change: D384E

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 45 149 1.3e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 508 1.2e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that this gene plays an important role in growth regulation. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for an ENU-induced mutation show cardiovascular phenotypes including persistent truncus arteriosus, atriventricular septal defects and vascular ring, as well as eye defects, short snout, micrognathia, cleft palate, tracheosophageal fistula, polydactyly and spleen hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Qsox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02392:Qsox1 APN 1 155,688,346 (GRCm39) missense probably damaging 1.00
BB003:Qsox1 UTSW 1 155,688,533 (GRCm39) missense unknown
BB013:Qsox1 UTSW 1 155,688,533 (GRCm39) missense unknown
R1799:Qsox1 UTSW 1 155,670,364 (GRCm39) missense probably null
R1833:Qsox1 UTSW 1 155,666,791 (GRCm39) missense probably benign 0.15
R1874:Qsox1 UTSW 1 155,688,385 (GRCm39) missense possibly damaging 0.85
R4282:Qsox1 UTSW 1 155,662,671 (GRCm39) critical splice acceptor site probably null
R4938:Qsox1 UTSW 1 155,655,414 (GRCm39) missense probably benign 0.01
R5081:Qsox1 UTSW 1 155,688,581 (GRCm39) utr 5 prime probably benign
R5217:Qsox1 UTSW 1 155,666,742 (GRCm39) missense probably benign 0.00
R5303:Qsox1 UTSW 1 155,655,039 (GRCm39) missense probably benign 0.01
R5761:Qsox1 UTSW 1 155,655,274 (GRCm39) missense probably benign
R5763:Qsox1 UTSW 1 155,655,625 (GRCm39) missense probably benign
R5932:Qsox1 UTSW 1 155,665,079 (GRCm39) missense probably benign
R6765:Qsox1 UTSW 1 155,666,851 (GRCm39) missense probably benign 0.00
R6802:Qsox1 UTSW 1 155,671,139 (GRCm39) missense probably damaging 1.00
R7926:Qsox1 UTSW 1 155,688,533 (GRCm39) missense unknown
R8857:Qsox1 UTSW 1 155,658,333 (GRCm39) missense possibly damaging 0.50
R8986:Qsox1 UTSW 1 155,666,829 (GRCm39) missense probably damaging 1.00
R9359:Qsox1 UTSW 1 155,658,343 (GRCm39) missense probably damaging 1.00
R9366:Qsox1 UTSW 1 155,665,162 (GRCm39) missense probably benign 0.01
R9403:Qsox1 UTSW 1 155,658,343 (GRCm39) missense probably damaging 1.00
R9621:Qsox1 UTSW 1 155,671,135 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCCTCCCACTAATACAGGATC -3'
(R):5'- TTATAAGGAGTCAAGGTTCCAGGG -3'

Sequencing Primer
(F):5'- CACTAATACAGGATCAGTCTAGCTG -3'
(R):5'- CAAGGTTCCAGGGACCTCGATAG -3'
Posted On 2022-11-14