Incidental Mutation 'R9803:Gm28042'
ID 735300
Institutional Source Beutler Lab
Gene Symbol Gm28042
Ensembl Gene ENSMUSG00000033852
Gene Name predicted gene, 28042
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.531) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 119857974-119873514 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119868984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 526 (V526E)
Ref Sequence ENSEMBL: ENSMUSP00000115498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126150] [ENSMUST00000129685] [ENSMUST00000156805] [ENSMUST00000162393]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000125805
SMART Domains Protein: ENSMUSP00000122869
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
Pfam:Cupin_8 2 62 2.8e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126150
AA Change: V303E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118458
Gene: ENSMUSG00000098488
AA Change: V303E

DomainStartEndE-ValueType
C2 19 119 1.79e-17 SMART
PLAc 233 789 1.99e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000129685
AA Change: V526E

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115498
Gene: ENSMUSG00000033852
AA Change: V526E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 1012 1.99e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156805
AA Change: V526E

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117535
Gene: ENSMUSG00000033852
AA Change: V526E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 892 8.56e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162393
SMART Domains Protein: ENSMUSP00000125329
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 242 4.42e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This locus represents naturally-occurring readthrough transcription between the neighboring Jmjd7 (jumonji domain containing 7) and Pla2g4b (phospholipase A2, group IVB (cytosolic)) genes on chromosome 2. The readthrough transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Gm28042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Gm28042 APN 2 119,860,837 (GRCm39) missense probably damaging 1.00
IGL01148:Gm28042 APN 2 119,869,519 (GRCm39) missense possibly damaging 0.74
IGL02005:Gm28042 APN 2 119,865,115 (GRCm39) missense possibly damaging 0.95
IGL02237:Gm28042 APN 2 119,870,380 (GRCm39) missense possibly damaging 0.61
IGL02539:Gm28042 APN 2 119,865,702 (GRCm39) missense probably damaging 1.00
IGL02747:Gm28042 APN 2 119,861,875 (GRCm39) missense probably damaging 1.00
IGL02825:Gm28042 APN 2 119,862,125 (GRCm39) missense probably damaging 0.99
IGL02998:Gm28042 APN 2 119,870,635 (GRCm39) missense possibly damaging 0.70
IGL03057:Gm28042 APN 2 119,862,637 (GRCm39) missense probably damaging 1.00
IGL03084:Gm28042 APN 2 119,870,986 (GRCm39) missense probably benign 0.08
IGL03160:Gm28042 APN 2 119,866,309 (GRCm39) missense possibly damaging 0.94
PIT4520001:Gm28042 UTSW 2 119,870,148 (GRCm39) nonsense probably null
R0147:Gm28042 UTSW 2 119,866,944 (GRCm39) missense probably benign 0.00
R0270:Gm28042 UTSW 2 119,872,073 (GRCm39) missense probably benign 0.06
R0315:Gm28042 UTSW 2 119,869,538 (GRCm39) missense probably damaging 1.00
R1421:Gm28042 UTSW 2 119,866,944 (GRCm39) missense probably benign 0.00
R1589:Gm28042 UTSW 2 119,871,887 (GRCm39) missense probably benign 0.05
R1599:Gm28042 UTSW 2 119,866,944 (GRCm39) missense probably benign 0.00
R1656:Gm28042 UTSW 2 119,869,370 (GRCm39) missense probably damaging 1.00
R1718:Gm28042 UTSW 2 119,866,872 (GRCm39) missense possibly damaging 0.78
R1969:Gm28042 UTSW 2 119,872,096 (GRCm39) makesense probably null
R2164:Gm28042 UTSW 2 119,867,229 (GRCm39) missense probably benign 0.01
R2275:Gm28042 UTSW 2 119,867,310 (GRCm39) missense probably damaging 1.00
R3976:Gm28042 UTSW 2 119,867,237 (GRCm39) missense probably benign 0.11
R4483:Gm28042 UTSW 2 119,866,321 (GRCm39) missense possibly damaging 0.68
R4614:Gm28042 UTSW 2 119,871,639 (GRCm39) missense probably damaging 0.99
R4802:Gm28042 UTSW 2 119,872,535 (GRCm39) utr 3 prime probably benign
R4976:Gm28042 UTSW 2 119,865,124 (GRCm39) missense probably damaging 1.00
R5119:Gm28042 UTSW 2 119,865,124 (GRCm39) missense probably damaging 1.00
R5177:Gm28042 UTSW 2 119,872,082 (GRCm39) splice site probably null
R5340:Gm28042 UTSW 2 119,871,929 (GRCm39) missense probably benign
R5861:Gm28042 UTSW 2 119,865,116 (GRCm39) missense probably damaging 1.00
R6641:Gm28042 UTSW 2 119,870,164 (GRCm39) missense probably damaging 1.00
R7187:Gm28042 UTSW 2 119,870,176 (GRCm39) missense probably damaging 1.00
R7488:Gm28042 UTSW 2 119,870,438 (GRCm39) missense probably benign 0.00
R7699:Gm28042 UTSW 2 119,870,197 (GRCm39) missense possibly damaging 0.81
R7700:Gm28042 UTSW 2 119,870,197 (GRCm39) missense possibly damaging 0.81
R8432:Gm28042 UTSW 2 119,869,077 (GRCm39) missense probably damaging 1.00
R9120:Gm28042 UTSW 2 119,869,462 (GRCm39) missense probably damaging 0.96
R9265:Gm28042 UTSW 2 119,871,705 (GRCm39) missense probably damaging 1.00
X0019:Gm28042 UTSW 2 119,870,139 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGCCCTGATGTTTGAAAC -3'
(R):5'- ATGGGGCCTAGGAATTCCTTC -3'

Sequencing Primer
(F):5'- GTTTGAAACAGCAAGACCTTTGG -3'
(R):5'- GGAATTCCTTCCCACTACATTCC -3'
Posted On 2022-11-14