Incidental Mutation 'R9803:Mrto4'
ID 735303
Institutional Source Beutler Lab
Gene Symbol Mrto4
Ensembl Gene ENSMUSG00000028741
Gene Name mRNA turnover 4, ribosome maturation factor
Synonyms 2610012O22Rik, Mrt4
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 139074751-139079887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139076381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 70 (N70I)
Ref Sequence ENSEMBL: ENSMUSP00000099561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030513] [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000102503] [ENSMUST00000147999] [ENSMUST00000155257] [ENSMUST00000179784]
AlphaFold Q9D0I8
Predicted Effect probably damaging
Transcript: ENSMUST00000030513
AA Change: N70I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030513
Gene: ENSMUSG00000028741
AA Change: N70I

DomainStartEndE-ValueType
Pfam:Ribosomal_L10 18 121 7.9e-23 PFAM
low complexity region 222 238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042096
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082262
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102503
AA Change: N70I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099561
Gene: ENSMUSG00000028741
AA Change: N70I

DomainStartEndE-ValueType
Pfam:Ribosomal_L10 18 121 4.6e-24 PFAM
low complexity region 223 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155257
AA Change: N23I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121453
Gene: ENSMUSG00000028741
AA Change: N23I

DomainStartEndE-ValueType
Pfam:Ribosomal_L10 1 61 4.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179784
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Mrto4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0083:Mrto4 UTSW 4 139,075,279 (GRCm39) missense possibly damaging 0.87
R0416:Mrto4 UTSW 4 139,077,043 (GRCm39) splice site probably null
R1959:Mrto4 UTSW 4 139,076,949 (GRCm39) missense probably damaging 0.98
R2062:Mrto4 UTSW 4 139,076,334 (GRCm39) missense probably benign 0.03
R2063:Mrto4 UTSW 4 139,076,334 (GRCm39) missense probably benign 0.03
R2065:Mrto4 UTSW 4 139,076,334 (GRCm39) missense probably benign 0.03
R2066:Mrto4 UTSW 4 139,076,334 (GRCm39) missense probably benign 0.03
R2067:Mrto4 UTSW 4 139,076,334 (GRCm39) missense probably benign 0.03
R5217:Mrto4 UTSW 4 139,075,770 (GRCm39) missense probably benign 0.14
R5436:Mrto4 UTSW 4 139,075,276 (GRCm39) missense probably damaging 1.00
R6173:Mrto4 UTSW 4 139,077,755 (GRCm39) missense probably benign 0.01
R7812:Mrto4 UTSW 4 139,075,278 (GRCm39) missense possibly damaging 0.77
R7944:Mrto4 UTSW 4 139,077,000 (GRCm39) missense probably benign 0.01
R9774:Mrto4 UTSW 4 139,075,287 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCTAGTAAGTAGGGGTCATAGCCC -3'
(R):5'- GAGCTGTCTCAAACTGTTGGC -3'

Sequencing Primer
(F):5'- CCCCATGGGTCTGGAGATTAAG -3'
(R):5'- ACTGTTGGCAAGATCCGATC -3'
Posted On 2022-11-14