Incidental Mutation 'R9803:Myo1h'
ID 735308
Institutional Source Beutler Lab
Gene Symbol Myo1h
Ensembl Gene ENSMUSG00000066952
Gene Name myosin 1H
Synonyms 4631401O15Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114427314-114502637 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114483997 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 548 (E548G)
Ref Sequence ENSEMBL: ENSMUSP00000132905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124316] [ENSMUST00000169347] [ENSMUST00000202006]
AlphaFold Q9D6A1
Predicted Effect possibly damaging
Transcript: ENSMUST00000124316
AA Change: E532G

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118824
Gene: ENSMUSG00000066952
AA Change: E532G

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 833 1015 5.8e-34 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000132905
Gene: ENSMUSG00000066952
AA Change: E548G

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000144110
Gene: ENSMUSG00000066952
AA Change: E532G

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Myo1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myo1h APN 5 114,453,132 (GRCm39) splice site probably benign
IGL00922:Myo1h APN 5 114,498,546 (GRCm39) missense probably damaging 1.00
IGL01022:Myo1h APN 5 114,474,361 (GRCm39) missense possibly damaging 0.67
IGL01364:Myo1h APN 5 114,486,500 (GRCm39) missense probably damaging 1.00
IGL01469:Myo1h APN 5 114,499,330 (GRCm39) missense probably damaging 1.00
IGL01626:Myo1h APN 5 114,453,027 (GRCm39) missense probably damaging 1.00
IGL02026:Myo1h APN 5 114,461,505 (GRCm39) missense probably null 0.07
IGL02156:Myo1h APN 5 114,491,972 (GRCm39) splice site probably benign
IGL02164:Myo1h APN 5 114,472,157 (GRCm39) missense probably damaging 1.00
IGL02429:Myo1h APN 5 114,497,799 (GRCm39) splice site probably benign
IGL02562:Myo1h APN 5 114,496,053 (GRCm39) missense probably benign 0.06
IGL02938:Myo1h APN 5 114,497,000 (GRCm39) missense probably damaging 1.00
R0056:Myo1h UTSW 5 114,468,273 (GRCm39) missense probably damaging 1.00
R0172:Myo1h UTSW 5 114,467,225 (GRCm39) splice site probably null
R0346:Myo1h UTSW 5 114,493,270 (GRCm39) missense probably benign 0.19
R0464:Myo1h UTSW 5 114,498,571 (GRCm39) missense probably damaging 1.00
R0556:Myo1h UTSW 5 114,457,852 (GRCm39) missense probably damaging 1.00
R0723:Myo1h UTSW 5 114,457,741 (GRCm39) missense probably benign 0.20
R0751:Myo1h UTSW 5 114,458,747 (GRCm39) missense probably damaging 1.00
R1470:Myo1h UTSW 5 114,457,765 (GRCm39) missense probably damaging 0.99
R1470:Myo1h UTSW 5 114,457,765 (GRCm39) missense probably damaging 0.99
R1579:Myo1h UTSW 5 114,485,496 (GRCm39) nonsense probably null
R1646:Myo1h UTSW 5 114,455,693 (GRCm39) missense possibly damaging 0.90
R1648:Myo1h UTSW 5 114,474,336 (GRCm39) missense probably damaging 1.00
R1981:Myo1h UTSW 5 114,491,898 (GRCm39) missense probably damaging 1.00
R2006:Myo1h UTSW 5 114,499,140 (GRCm39) missense probably damaging 1.00
R2697:Myo1h UTSW 5 114,493,274 (GRCm39) missense probably damaging 1.00
R3124:Myo1h UTSW 5 114,466,860 (GRCm39) missense probably benign 0.04
R3195:Myo1h UTSW 5 114,466,801 (GRCm39) missense probably benign
R4255:Myo1h UTSW 5 114,468,198 (GRCm39) missense possibly damaging 0.89
R4613:Myo1h UTSW 5 114,489,737 (GRCm39) missense probably benign 0.02
R4613:Myo1h UTSW 5 114,486,440 (GRCm39) missense possibly damaging 0.73
R4758:Myo1h UTSW 5 114,487,643 (GRCm39) missense probably damaging 1.00
R4784:Myo1h UTSW 5 114,498,660 (GRCm39) missense possibly damaging 0.46
R4785:Myo1h UTSW 5 114,498,660 (GRCm39) missense possibly damaging 0.46
R5511:Myo1h UTSW 5 114,483,958 (GRCm39) nonsense probably null
R5663:Myo1h UTSW 5 114,472,155 (GRCm39) missense probably damaging 1.00
R6186:Myo1h UTSW 5 114,457,864 (GRCm39) missense possibly damaging 0.90
R6243:Myo1h UTSW 5 114,500,208 (GRCm39) missense probably damaging 1.00
R6344:Myo1h UTSW 5 114,466,776 (GRCm39) missense probably damaging 1.00
R6345:Myo1h UTSW 5 114,489,769 (GRCm39) missense probably damaging 1.00
R6383:Myo1h UTSW 5 114,474,325 (GRCm39) missense probably damaging 1.00
R6444:Myo1h UTSW 5 114,453,017 (GRCm39) missense possibly damaging 0.63
R6787:Myo1h UTSW 5 114,458,714 (GRCm39) missense probably damaging 1.00
R6891:Myo1h UTSW 5 114,487,673 (GRCm39) missense probably damaging 1.00
R6990:Myo1h UTSW 5 114,468,221 (GRCm39) missense probably damaging 0.97
R7040:Myo1h UTSW 5 114,497,805 (GRCm39) missense possibly damaging 0.67
R7101:Myo1h UTSW 5 114,480,258 (GRCm39) missense
R7121:Myo1h UTSW 5 114,476,290 (GRCm39) missense
R7206:Myo1h UTSW 5 114,457,836 (GRCm39) nonsense probably null
R7222:Myo1h UTSW 5 114,493,322 (GRCm39) critical splice donor site probably null
R7838:Myo1h UTSW 5 114,466,872 (GRCm39) splice site probably null
R7896:Myo1h UTSW 5 114,474,372 (GRCm39) splice site probably null
R8004:Myo1h UTSW 5 114,458,769 (GRCm39) missense
R8323:Myo1h UTSW 5 114,480,200 (GRCm39) missense
R8874:Myo1h UTSW 5 114,472,163 (GRCm39) missense
R8945:Myo1h UTSW 5 114,470,784 (GRCm39) missense probably damaging 1.00
R9432:Myo1h UTSW 5 114,499,366 (GRCm39) missense possibly damaging 0.92
R9518:Myo1h UTSW 5 114,497,588 (GRCm39) missense probably damaging 0.99
R9527:Myo1h UTSW 5 114,453,098 (GRCm39) missense
R9548:Myo1h UTSW 5 114,499,154 (GRCm39) missense probably benign 0.16
R9687:Myo1h UTSW 5 114,458,769 (GRCm39) missense
Z1177:Myo1h UTSW 5 114,472,217 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GGAAACCCCATGTCACCAGG -3'
(R):5'- AATCTCAGTCAGCTTTAAAACAGG -3'

Sequencing Primer
(F):5'- TGCTGTGAACAGACACCTTG -3'
(R):5'- CAGTTCCTGGCTGCAAACTGATG -3'
Posted On 2022-11-14