Incidental Mutation 'R9803:Inpp5f'
ID 735319
Institutional Source Beutler Lab
Gene Symbol Inpp5f
Ensembl Gene ENSMUSG00000042105
Gene Name inositol polyphosphate-5-phosphatase F
Synonyms cI-27, 5830435P03Rik, SAC2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 128213052-128298149 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 128278515 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 435 (D435A)
Ref Sequence ENSEMBL: ENSMUSP00000045910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043138]
AlphaFold Q8CDA1
Predicted Effect possibly damaging
Transcript: ENSMUST00000043138
AA Change: D435A

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045910
Gene: ENSMUSG00000042105
AA Change: D435A

DomainStartEndE-ValueType
Pfam:Syja_N 49 416 1.2e-85 PFAM
Blast:IPPc 449 568 6e-13 BLAST
Pfam:hSac2 590 698 9.1e-25 PFAM
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1059 1065 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased isoproterenol-induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Inpp5f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Inpp5f APN 7 128,265,991 (GRCm39) missense probably benign 0.04
IGL01316:Inpp5f APN 7 128,292,430 (GRCm39) splice site probably benign
IGL01455:Inpp5f APN 7 128,279,773 (GRCm39) missense probably damaging 1.00
IGL01471:Inpp5f APN 7 128,277,122 (GRCm39) missense probably damaging 0.99
IGL01590:Inpp5f APN 7 128,266,031 (GRCm39) critical splice donor site probably null
IGL01942:Inpp5f APN 7 128,269,493 (GRCm39) missense probably damaging 1.00
IGL02092:Inpp5f APN 7 128,286,948 (GRCm39) missense probably damaging 1.00
IGL02137:Inpp5f APN 7 128,296,853 (GRCm39) missense probably damaging 1.00
IGL02664:Inpp5f APN 7 128,265,738 (GRCm39) missense probably damaging 1.00
IGL02812:Inpp5f APN 7 128,284,030 (GRCm39) missense probably damaging 1.00
IGL02942:Inpp5f APN 7 128,296,624 (GRCm39) missense probably benign 0.29
PIT4480001:Inpp5f UTSW 7 128,286,858 (GRCm39) missense probably benign 0.32
PIT4812001:Inpp5f UTSW 7 128,294,032 (GRCm39) missense probably benign 0.39
R0243:Inpp5f UTSW 7 128,296,907 (GRCm39) missense probably damaging 1.00
R0346:Inpp5f UTSW 7 128,292,392 (GRCm39) missense probably damaging 1.00
R1186:Inpp5f UTSW 7 128,296,307 (GRCm39) missense probably benign
R1375:Inpp5f UTSW 7 128,265,753 (GRCm39) nonsense probably null
R1918:Inpp5f UTSW 7 128,265,693 (GRCm39) splice site probably benign
R2307:Inpp5f UTSW 7 128,296,034 (GRCm39) missense probably damaging 1.00
R3716:Inpp5f UTSW 7 128,292,394 (GRCm39) missense probably damaging 1.00
R4157:Inpp5f UTSW 7 128,281,423 (GRCm39) intron probably benign
R4647:Inpp5f UTSW 7 128,260,833 (GRCm39) missense possibly damaging 0.94
R4705:Inpp5f UTSW 7 128,265,711 (GRCm39) missense probably damaging 0.97
R4713:Inpp5f UTSW 7 128,265,449 (GRCm39) missense probably damaging 0.99
R4818:Inpp5f UTSW 7 128,286,853 (GRCm39) missense probably damaging 1.00
R4914:Inpp5f UTSW 7 128,286,840 (GRCm39) missense probably damaging 1.00
R4915:Inpp5f UTSW 7 128,286,840 (GRCm39) missense probably damaging 1.00
R4917:Inpp5f UTSW 7 128,286,840 (GRCm39) missense probably damaging 1.00
R5069:Inpp5f UTSW 7 128,278,451 (GRCm39) critical splice acceptor site probably null
R5181:Inpp5f UTSW 7 128,281,555 (GRCm39) missense probably damaging 1.00
R5234:Inpp5f UTSW 7 128,265,407 (GRCm39) missense probably benign
R6299:Inpp5f UTSW 7 128,237,884 (GRCm39) missense possibly damaging 0.87
R6389:Inpp5f UTSW 7 128,279,780 (GRCm39) missense probably damaging 1.00
R6530:Inpp5f UTSW 7 128,265,802 (GRCm39) nonsense probably null
R6545:Inpp5f UTSW 7 128,296,280 (GRCm39) missense possibly damaging 0.88
R7259:Inpp5f UTSW 7 128,271,681 (GRCm39) missense probably benign 0.00
R7383:Inpp5f UTSW 7 128,296,310 (GRCm39) missense probably damaging 1.00
R7427:Inpp5f UTSW 7 128,281,529 (GRCm39) missense probably damaging 1.00
R7428:Inpp5f UTSW 7 128,281,529 (GRCm39) missense probably damaging 1.00
R7679:Inpp5f UTSW 7 128,296,247 (GRCm39) missense possibly damaging 0.68
R7809:Inpp5f UTSW 7 128,269,367 (GRCm39) missense probably damaging 1.00
R7840:Inpp5f UTSW 7 128,296,526 (GRCm39) missense probably benign
R7912:Inpp5f UTSW 7 128,294,037 (GRCm39) missense probably benign
R7915:Inpp5f UTSW 7 128,269,433 (GRCm39) missense probably benign 0.25
R7960:Inpp5f UTSW 7 128,295,638 (GRCm39) splice site probably null
R8027:Inpp5f UTSW 7 128,292,397 (GRCm39) missense probably damaging 1.00
R8154:Inpp5f UTSW 7 128,265,991 (GRCm39) missense possibly damaging 0.73
R8213:Inpp5f UTSW 7 128,281,529 (GRCm39) missense probably damaging 1.00
R9499:Inpp5f UTSW 7 128,295,437 (GRCm39) missense possibly damaging 0.62
R9519:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9544:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9597:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9598:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9634:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9701:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9702:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9784:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9802:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
RF001:Inpp5f UTSW 7 128,296,807 (GRCm39) missense probably damaging 1.00
X0061:Inpp5f UTSW 7 128,284,021 (GRCm39) missense probably damaging 1.00
Z1088:Inpp5f UTSW 7 128,296,673 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCCTGGACACACAGAGACT -3'
(R):5'- GACCAAAAGTCAAAACAACGTTT -3'

Sequencing Primer
(F):5'- TGCTGGCATTAAAACCTGAGC -3'
(R):5'- GTGCTTATGAGTCAGACGAACACTC -3'
Posted On 2022-11-14