Mutagenetix > Incidental Mutation

Incidental Mutation 'R9803:Inpp5f'

735319

Institutional Source

Beutler Lab

Gene Symbol

Inpp5f

Ensembl Gene

ENSMUSG00000042105

Gene Name

inositol polyphosphate-5-phosphatase F

Synonyms

cI-27, 5830435P03Rik, SAC2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.295) question?

Stock #

R9803 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128611328-128696425 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 128676791 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 435 (D435A)

Ref Sequence

ENSEMBL: ENSMUSP00000045910 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043138]

AlphaFold

Q8CDA1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043138
AA Change: D435A

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000045910
Gene: ENSMUSG00000042105
AA Change: D435A

Domain	Start	End	E-Value	Type
Pfam:Syja_N	49	416	1.2e-85	PFAM
Blast:IPPc	449	568	6e-13	BLAST
Pfam:hSac2	590	698	9.1e-25	PFAM
low complexity region	1042	1054	N/A	INTRINSIC
low complexity region	1059	1065	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased isoproterenol-induced cardiac hypertrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	G	5: 113,703,903	S52P	unknown	Het
Ank2	A	G	3: 126,959,077	M330T	possibly damaging	Het
Ankar	C	T	1: 72,659,181	V905I	possibly damaging	Het
Anln	G	T	9: 22,372,222	D438E	probably damaging	Het
C1ql3	T	C	2: 13,004,389	N215S	probably damaging	Het
Ccdc110	A	G	8: 45,942,589	S506G	probably benign	Het
Ccdc87	A	G	19: 4,841,147	T556A	probably benign	Het
Cma1	A	T	14: 55,941,729	N236K	probably benign	Het
Csmd2	T	C	4: 128,369,193	F724S		Het
Cts8	T	C	13: 61,253,322	K130R	possibly damaging	Het
Daam1	A	T	12: 71,944,148	T179S	unknown	Het
Fancd2os	T	C	6: 113,597,977	T23A	possibly damaging	Het
Gbgt1	T	A	2: 28,504,854	I168N	probably damaging	Het
Gckr	G	A	5: 31,300,024	G127D	probably damaging	Het
Gm11444	G	A	11: 85,846,873	Q164*	probably null	Het
Gm28042	T	A	2: 120,038,503	V526E	possibly damaging	Het
Gm8947	T	C	1: 151,192,971	V185A	possibly damaging	Het
Hoxd13	C	A	2: 74,668,903	H198Q	possibly damaging	Het
Hps6	T	A	19: 46,005,508	L628*	probably null	Het
Igha	G	A	12: 113,259,139	H221Y		Het
Ighm	A	G	12: 113,419,015	S453P		Het
Lfng	A	G	5: 140,607,773	T120A	probably damaging	Het
Lrrc4	C	T	6: 28,662,200	A172T	probably benign	Het
Lrrc56	A	G	7: 141,207,607	T386A	probably benign	Het
Mapkbp1	A	T	2: 120,010,775	H81L	probably benign	Het
Mfsd14b	C	A	13: 65,073,600	V293L	probably benign	Het
Mrto4	T	A	4: 139,349,070	N70I	probably damaging	Het
Mxra8	C	T	4: 155,839,825		probably benign	Het
Myo1h	A	G	5: 114,345,936	E548G		Het
Ncan	C	T	8: 70,108,101	D739N	probably benign	Het
Olfr315	T	C	11: 58,778,769	V214A	probably benign	Het
Oxgr1	T	C	14: 120,022,151	T215A	possibly damaging	Het
Pcdhgb7	T	A	18: 37,752,035	V86E	probably damaging	Het
Pclo	G	A	5: 14,712,615	V416M		Het
Phf3	G	T	1: 30,830,791	T392K	probably benign	Het
Pkhd1	A	T	1: 20,566,849	V379E	probably damaging	Het
Ppfia3	T	C	7: 45,341,115	Y1080C	probably benign	Het
Ptprs	C	A	17: 56,422,217	G1254C	probably damaging	Het
Qsox1	A	T	1: 155,782,670	D384E	probably benign	Het
Rergl	A	G	6: 139,500,763	F23L	probably damaging	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Sidt2	A	G	9: 45,943,614	Y588H	probably damaging	Het
Tas2r139	T	A	6: 42,141,132	I66K	probably damaging	Het
Tbc1d30	T	A	10: 121,272,075	D474V	probably damaging	Het
Tenm4	G	A	7: 96,553,478	G100D	probably damaging	Het
Tmem258	G	A	19: 10,207,273	V75I	probably benign	Het
Tmem91	G	T	7: 25,670,563	H95N	probably damaging	Het
Trps1	T	C	15: 50,846,694	K87E	possibly damaging	Het
Tspan11	T	A	6: 127,943,717	M209K	probably benign	Het
Tspan17	C	A	13: 54,793,279	Q124K	probably benign	Het
Uts2b	G	A	16: 27,360,942	R105*	probably null	Het
Vmn2r110	T	A	17: 20,583,468	T282S	probably benign	Het
Xdh	T	A	17: 73,922,460	M333L	probably benign	Het
Zbtb3	A	G	19: 8,804,469	E482G	probably damaging	Het

Other mutations in Inpp5f

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Inpp5f	APN	7	128664267	missense	probably benign	0.04
IGL01316:Inpp5f	APN	7	128690706	splice site	probably benign
IGL01455:Inpp5f	APN	7	128678049	missense	probably damaging	1.00
IGL01471:Inpp5f	APN	7	128675398	missense	probably damaging	0.99
IGL01590:Inpp5f	APN	7	128664307	critical splice donor site	probably null
IGL01942:Inpp5f	APN	7	128667769	missense	probably damaging	1.00
IGL02092:Inpp5f	APN	7	128685224	missense	probably damaging	1.00
IGL02137:Inpp5f	APN	7	128695129	missense	probably damaging	1.00
IGL02664:Inpp5f	APN	7	128664014	missense	probably damaging	1.00
IGL02812:Inpp5f	APN	7	128682306	missense	probably damaging	1.00
IGL02942:Inpp5f	APN	7	128694900	missense	probably benign	0.29
PIT4480001:Inpp5f	UTSW	7	128685134	missense	probably benign	0.32
PIT4812001:Inpp5f	UTSW	7	128692308	missense	probably benign	0.39
R0243:Inpp5f	UTSW	7	128695183	missense	probably damaging	1.00
R0346:Inpp5f	UTSW	7	128690668	missense	probably damaging	1.00
R1186:Inpp5f	UTSW	7	128694583	missense	probably benign
R1375:Inpp5f	UTSW	7	128664029	nonsense	probably null
R1918:Inpp5f	UTSW	7	128663969	splice site	probably benign
R2307:Inpp5f	UTSW	7	128694310	missense	probably damaging	1.00
R3716:Inpp5f	UTSW	7	128690670	missense	probably damaging	1.00
R4157:Inpp5f	UTSW	7	128679699	intron	probably benign
R4647:Inpp5f	UTSW	7	128659109	missense	possibly damaging	0.94
R4705:Inpp5f	UTSW	7	128663987	missense	probably damaging	0.97
R4713:Inpp5f	UTSW	7	128663725	missense	probably damaging	0.99
R4818:Inpp5f	UTSW	7	128685129	missense	probably damaging	1.00
R4914:Inpp5f	UTSW	7	128685116	missense	probably damaging	1.00
R4915:Inpp5f	UTSW	7	128685116	missense	probably damaging	1.00
R4917:Inpp5f	UTSW	7	128685116	missense	probably damaging	1.00
R5069:Inpp5f	UTSW	7	128676727	critical splice acceptor site	probably null
R5181:Inpp5f	UTSW	7	128679831	missense	probably damaging	1.00
R5234:Inpp5f	UTSW	7	128663683	missense	probably benign
R6299:Inpp5f	UTSW	7	128636160	missense	possibly damaging	0.87
R6389:Inpp5f	UTSW	7	128678056	missense	probably damaging	1.00
R6530:Inpp5f	UTSW	7	128664078	nonsense	probably null
R6545:Inpp5f	UTSW	7	128694556	missense	possibly damaging	0.88
R7259:Inpp5f	UTSW	7	128669957	missense	probably benign	0.00
R7383:Inpp5f	UTSW	7	128694586	missense	probably damaging	1.00
R7427:Inpp5f	UTSW	7	128679805	missense	probably damaging	1.00
R7428:Inpp5f	UTSW	7	128679805	missense	probably damaging	1.00
R7679:Inpp5f	UTSW	7	128694523	missense	possibly damaging	0.68
R7809:Inpp5f	UTSW	7	128667643	missense	probably damaging	1.00
R7840:Inpp5f	UTSW	7	128694802	missense	probably benign
R7912:Inpp5f	UTSW	7	128692313	missense	probably benign
R7915:Inpp5f	UTSW	7	128667709	missense	probably benign	0.25
R7960:Inpp5f	UTSW	7	128693914	splice site	probably null
R8027:Inpp5f	UTSW	7	128690673	missense	probably damaging	1.00
R8154:Inpp5f	UTSW	7	128664267	missense	possibly damaging	0.73
R8213:Inpp5f	UTSW	7	128679805	missense	probably damaging	1.00
R9499:Inpp5f	UTSW	7	128693713	missense	possibly damaging	0.62
R9519:Inpp5f	UTSW	7	128676791	missense	possibly damaging	0.62
R9544:Inpp5f	UTSW	7	128676791	missense	possibly damaging	0.62
R9597:Inpp5f	UTSW	7	128676791	missense	possibly damaging	0.62
R9598:Inpp5f	UTSW	7	128676791	missense	possibly damaging	0.62
R9634:Inpp5f	UTSW	7	128676791	missense	possibly damaging	0.62
R9701:Inpp5f	UTSW	7	128676791	missense	possibly damaging	0.62
R9702:Inpp5f	UTSW	7	128676791	missense	possibly damaging	0.62
R9784:Inpp5f	UTSW	7	128676791	missense	possibly damaging	0.62
R9802:Inpp5f	UTSW	7	128676791	missense	possibly damaging	0.62
RF001:Inpp5f	UTSW	7	128695083	missense	probably damaging	1.00
X0061:Inpp5f	UTSW	7	128682297	missense	probably damaging	1.00
Z1088:Inpp5f	UTSW	7	128694949	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GCCTGGACACACAGAGACT -3'
(R):5'- GACCAAAAGTCAAAACAACGTTT -3'

Sequencing Primer
(F):5'- TGCTGGCATTAAAACCTGAGC -3'
(R):5'- GTGCTTATGAGTCAGACGAACACTC -3'

Posted On

2022-11-14