Incidental Mutation 'R9803:Ccdc110'
ID 735321
Institutional Source Beutler Lab
Gene Symbol Ccdc110
Ensembl Gene ENSMUSG00000071104
Gene Name coiled-coil domain containing 110
Synonyms LOC212392
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 46387656-46397182 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46395626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 506 (S506G)
Ref Sequence ENSEMBL: ENSMUSP00000092964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095326] [ENSMUST00000174815]
AlphaFold Q3V125
Predicted Effect probably benign
Transcript: ENSMUST00000095326
AA Change: S506G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092964
Gene: ENSMUSG00000071104
AA Change: S506G

DomainStartEndE-ValueType
coiled coil region 442 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174815
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Ccdc110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Ccdc110 APN 8 46,395,161 (GRCm39) missense possibly damaging 0.76
IGL02175:Ccdc110 APN 8 46,393,660 (GRCm39) missense probably benign 0.07
IGL02471:Ccdc110 APN 8 46,394,793 (GRCm39) missense probably benign 0.14
IGL02524:Ccdc110 APN 8 46,394,979 (GRCm39) missense probably benign
IGL02887:Ccdc110 APN 8 46,396,221 (GRCm39) missense probably benign 0.01
IGL03227:Ccdc110 APN 8 46,394,586 (GRCm39) missense probably damaging 1.00
IGL03238:Ccdc110 APN 8 46,394,859 (GRCm39) missense probably benign 0.00
droll UTSW 8 46,395,864 (GRCm39) missense probably benign 0.10
humorless UTSW 8 46,396,487 (GRCm39) missense probably benign 0.03
R0049:Ccdc110 UTSW 8 46,395,663 (GRCm39) missense probably damaging 1.00
R0049:Ccdc110 UTSW 8 46,395,663 (GRCm39) missense probably damaging 1.00
R0110:Ccdc110 UTSW 8 46,388,194 (GRCm39) missense probably benign 0.00
R0189:Ccdc110 UTSW 8 46,388,119 (GRCm39) missense probably damaging 0.98
R0218:Ccdc110 UTSW 8 46,387,761 (GRCm39) splice site probably benign
R0280:Ccdc110 UTSW 8 46,396,487 (GRCm39) missense probably benign 0.03
R0332:Ccdc110 UTSW 8 46,396,001 (GRCm39) nonsense probably null
R0371:Ccdc110 UTSW 8 46,395,843 (GRCm39) missense possibly damaging 0.86
R0469:Ccdc110 UTSW 8 46,388,194 (GRCm39) missense probably benign 0.00
R0502:Ccdc110 UTSW 8 46,387,761 (GRCm39) splice site probably benign
R0510:Ccdc110 UTSW 8 46,388,194 (GRCm39) missense probably benign 0.00
R0534:Ccdc110 UTSW 8 46,388,175 (GRCm39) missense possibly damaging 0.73
R0647:Ccdc110 UTSW 8 46,396,425 (GRCm39) missense probably damaging 0.99
R0714:Ccdc110 UTSW 8 46,396,047 (GRCm39) missense possibly damaging 0.71
R0721:Ccdc110 UTSW 8 46,395,026 (GRCm39) missense probably benign
R1029:Ccdc110 UTSW 8 46,394,817 (GRCm39) missense probably damaging 0.98
R1147:Ccdc110 UTSW 8 46,397,121 (GRCm39) missense possibly damaging 0.64
R1147:Ccdc110 UTSW 8 46,397,121 (GRCm39) missense possibly damaging 0.64
R1170:Ccdc110 UTSW 8 46,394,922 (GRCm39) missense probably benign 0.22
R1340:Ccdc110 UTSW 8 46,395,218 (GRCm39) missense probably benign 0.02
R1540:Ccdc110 UTSW 8 46,395,362 (GRCm39) nonsense probably null
R1587:Ccdc110 UTSW 8 46,394,783 (GRCm39) missense probably benign 0.01
R1602:Ccdc110 UTSW 8 46,391,955 (GRCm39) missense probably benign 0.12
R1629:Ccdc110 UTSW 8 46,395,164 (GRCm39) missense probably benign 0.08
R1842:Ccdc110 UTSW 8 46,393,605 (GRCm39) missense probably damaging 1.00
R1933:Ccdc110 UTSW 8 46,396,287 (GRCm39) missense probably damaging 1.00
R1934:Ccdc110 UTSW 8 46,396,287 (GRCm39) missense probably damaging 1.00
R2006:Ccdc110 UTSW 8 46,396,349 (GRCm39) missense probably damaging 1.00
R2043:Ccdc110 UTSW 8 46,395,864 (GRCm39) missense probably benign 0.10
R2093:Ccdc110 UTSW 8 46,395,114 (GRCm39) missense probably damaging 1.00
R2165:Ccdc110 UTSW 8 46,395,876 (GRCm39) missense probably benign 0.00
R3613:Ccdc110 UTSW 8 46,395,843 (GRCm39) missense possibly damaging 0.86
R3923:Ccdc110 UTSW 8 46,395,426 (GRCm39) missense probably damaging 1.00
R4648:Ccdc110 UTSW 8 46,395,705 (GRCm39) missense possibly damaging 0.95
R4773:Ccdc110 UTSW 8 46,396,245 (GRCm39) missense probably damaging 1.00
R4901:Ccdc110 UTSW 8 46,396,437 (GRCm39) missense probably benign 0.35
R4911:Ccdc110 UTSW 8 46,395,944 (GRCm39) missense probably benign 0.00
R4923:Ccdc110 UTSW 8 46,396,460 (GRCm39) missense probably benign 0.29
R5104:Ccdc110 UTSW 8 46,395,729 (GRCm39) missense probably damaging 0.99
R5561:Ccdc110 UTSW 8 46,393,646 (GRCm39) missense probably benign 0.02
R5966:Ccdc110 UTSW 8 46,395,573 (GRCm39) missense probably damaging 1.00
R5976:Ccdc110 UTSW 8 46,396,536 (GRCm39) missense possibly damaging 0.71
R6141:Ccdc110 UTSW 8 46,394,807 (GRCm39) missense possibly damaging 0.89
R6326:Ccdc110 UTSW 8 46,395,078 (GRCm39) missense probably damaging 1.00
R6366:Ccdc110 UTSW 8 46,396,425 (GRCm39) missense probably damaging 0.99
R6405:Ccdc110 UTSW 8 46,394,734 (GRCm39) nonsense probably null
R6482:Ccdc110 UTSW 8 46,395,825 (GRCm39) missense probably benign 0.00
R6815:Ccdc110 UTSW 8 46,395,024 (GRCm39) missense probably benign 0.19
R7387:Ccdc110 UTSW 8 46,395,233 (GRCm39) missense probably benign 0.00
R7680:Ccdc110 UTSW 8 46,394,688 (GRCm39) missense possibly damaging 0.64
R8099:Ccdc110 UTSW 8 46,395,130 (GRCm39) missense probably damaging 1.00
R8114:Ccdc110 UTSW 8 46,396,140 (GRCm39) missense probably damaging 1.00
R8151:Ccdc110 UTSW 8 46,395,830 (GRCm39) missense probably damaging 1.00
R8295:Ccdc110 UTSW 8 46,396,416 (GRCm39) missense probably damaging 0.97
R8532:Ccdc110 UTSW 8 46,396,032 (GRCm39) missense probably damaging 1.00
R9072:Ccdc110 UTSW 8 46,395,875 (GRCm39) missense probably benign 0.00
R9073:Ccdc110 UTSW 8 46,395,875 (GRCm39) missense probably benign 0.00
R9088:Ccdc110 UTSW 8 46,394,882 (GRCm39) missense probably damaging 0.99
X0053:Ccdc110 UTSW 8 46,395,998 (GRCm39) missense possibly damaging 0.56
X0054:Ccdc110 UTSW 8 46,394,880 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGTCGCCAAAATTCATTAC -3'
(R):5'- GCCATGTCACTTTGGGACTTG -3'

Sequencing Primer
(F):5'- GTCGCCAAAATTCATTACCTACAG -3'
(R):5'- CCATGTCACTTTGGGACTTGTGTTC -3'
Posted On 2022-11-14