Incidental Mutation 'R9803:Anln'
ID 735323
Institutional Source Beutler Lab
Gene Symbol Anln
Ensembl Gene ENSMUSG00000036777
Gene Name anillin, actin binding protein
Synonyms 1110037A17Rik, Scraps, 2900037I21Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 22243308-22300484 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 22283518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 438 (D438E)
Ref Sequence ENSEMBL: ENSMUSP00000045873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040912]
AlphaFold Q8K298
Predicted Effect probably damaging
Transcript: ENSMUST00000040912
AA Change: D438E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045873
Gene: ENSMUSG00000036777
AA Change: D438E

DomainStartEndE-ValueType
low complexity region 97 121 N/A INTRINSIC
Pfam:Anillin_N 141 227 5e-34 PFAM
low complexity region 234 250 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
Pfam:Anillin_N 423 501 2.7e-6 PFAM
coiled coil region 566 599 N/A INTRINSIC
coiled coil region 710 729 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
Pfam:Anillin 797 950 8.8e-39 PFAM
PH 981 1106 1.8e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin-binding protein that plays a role in cell growth and migration, and in cytokinesis. The encoded protein is thought to regulate actin cytoskeletal dynamics in podocytes, components of the glomerulus. Mutations in this gene are associated with focal segmental glomerulosclerosis 8. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Anln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Anln APN 9 22,272,120 (GRCm39) nonsense probably null
IGL01634:Anln APN 9 22,271,771 (GRCm39) missense probably benign 0.00
IGL02145:Anln APN 9 22,250,292 (GRCm39) splice site probably null
IGL02296:Anln APN 9 22,283,483 (GRCm39) missense possibly damaging 0.67
IGL02352:Anln APN 9 22,279,708 (GRCm39) missense probably benign 0.00
IGL02601:Anln APN 9 22,249,331 (GRCm39) missense probably damaging 0.99
IGL02821:Anln APN 9 22,269,418 (GRCm39) missense possibly damaging 0.55
IGL02863:Anln APN 9 22,287,661 (GRCm39) missense probably damaging 1.00
IGL03274:Anln APN 9 22,293,565 (GRCm39) missense probably damaging 1.00
R0114:Anln UTSW 9 22,264,642 (GRCm39) missense probably damaging 0.99
R0486:Anln UTSW 9 22,264,122 (GRCm39) missense probably benign 0.31
R0712:Anln UTSW 9 22,291,594 (GRCm39) missense probably benign 0.01
R1618:Anln UTSW 9 22,262,214 (GRCm39) critical splice donor site probably null
R1734:Anln UTSW 9 22,262,251 (GRCm39) missense possibly damaging 0.71
R1856:Anln UTSW 9 22,264,627 (GRCm39) missense probably damaging 1.00
R1999:Anln UTSW 9 22,244,348 (GRCm39) makesense probably null
R2073:Anln UTSW 9 22,244,464 (GRCm39) missense probably benign 0.45
R2075:Anln UTSW 9 22,244,464 (GRCm39) missense probably benign 0.45
R2696:Anln UTSW 9 22,272,259 (GRCm39) missense probably benign 0.08
R2943:Anln UTSW 9 22,267,342 (GRCm39) splice site probably null
R4278:Anln UTSW 9 22,245,296 (GRCm39) critical splice donor site probably null
R4548:Anln UTSW 9 22,274,184 (GRCm39) missense possibly damaging 0.80
R4887:Anln UTSW 9 22,291,484 (GRCm39) missense possibly damaging 0.46
R4979:Anln UTSW 9 22,287,797 (GRCm39) missense probably benign
R5087:Anln UTSW 9 22,286,340 (GRCm39) missense possibly damaging 0.61
R5197:Anln UTSW 9 22,264,077 (GRCm39) critical splice donor site probably null
R5353:Anln UTSW 9 22,271,813 (GRCm39) missense probably damaging 1.00
R5748:Anln UTSW 9 22,249,230 (GRCm39) missense probably damaging 0.97
R5863:Anln UTSW 9 22,249,280 (GRCm39) missense probably damaging 0.99
R6146:Anln UTSW 9 22,287,604 (GRCm39) nonsense probably null
R6152:Anln UTSW 9 22,271,803 (GRCm39) missense probably damaging 0.98
R6170:Anln UTSW 9 22,279,793 (GRCm39) missense probably benign 0.01
R6261:Anln UTSW 9 22,275,342 (GRCm39) missense probably damaging 1.00
R6264:Anln UTSW 9 22,245,413 (GRCm39) missense possibly damaging 0.82
R6656:Anln UTSW 9 22,262,298 (GRCm39) missense probably damaging 1.00
R6864:Anln UTSW 9 22,293,545 (GRCm39) missense probably benign 0.36
R7514:Anln UTSW 9 22,272,153 (GRCm39) missense probably damaging 0.96
R7789:Anln UTSW 9 22,263,333 (GRCm39) missense
R7807:Anln UTSW 9 22,272,176 (GRCm39) missense probably damaging 1.00
R7840:Anln UTSW 9 22,274,019 (GRCm39) missense probably benign 0.03
R7912:Anln UTSW 9 22,269,965 (GRCm39) missense possibly damaging 0.53
R8246:Anln UTSW 9 22,262,251 (GRCm39) missense probably benign 0.00
R8720:Anln UTSW 9 22,284,573 (GRCm39) missense probably benign 0.00
R8839:Anln UTSW 9 22,267,468 (GRCm39) missense probably benign 0.02
R9054:Anln UTSW 9 22,272,116 (GRCm39) critical splice donor site probably null
R9094:Anln UTSW 9 22,249,283 (GRCm39) missense probably benign 0.03
R9507:Anln UTSW 9 22,274,136 (GRCm39) missense probably damaging 1.00
R9683:Anln UTSW 9 22,283,536 (GRCm39) nonsense probably null
R9802:Anln UTSW 9 22,245,453 (GRCm39) missense probably damaging 0.99
Z1088:Anln UTSW 9 22,274,097 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAATGATGGTGGTCTTCAAAC -3'
(R):5'- ACATCGTACTCTACTTGTGTTGTG -3'

Sequencing Primer
(F):5'- TGTCACCGAAGCACTTGG -3'
(R):5'- GGCTGATCTCAAACTAGCTGATAGC -3'
Posted On 2022-11-14