Incidental Mutation 'R9803:Anln'
ID 735323
Institutional Source Beutler Lab
Gene Symbol Anln
Ensembl Gene ENSMUSG00000036777
Gene Name anillin, actin binding protein
Synonyms 1110037A17Rik, 2900037I21Rik, Scraps
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.971) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 22332012-22389188 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 22372222 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 438 (D438E)
Ref Sequence ENSEMBL: ENSMUSP00000045873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040912]
AlphaFold Q8K298
Predicted Effect probably damaging
Transcript: ENSMUST00000040912
AA Change: D438E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045873
Gene: ENSMUSG00000036777
AA Change: D438E

DomainStartEndE-ValueType
low complexity region 97 121 N/A INTRINSIC
Pfam:Anillin_N 141 227 5e-34 PFAM
low complexity region 234 250 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
Pfam:Anillin_N 423 501 2.7e-6 PFAM
coiled coil region 566 599 N/A INTRINSIC
coiled coil region 710 729 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
Pfam:Anillin 797 950 8.8e-39 PFAM
PH 981 1106 1.8e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin-binding protein that plays a role in cell growth and migration, and in cytokinesis. The encoded protein is thought to regulate actin cytoskeletal dynamics in podocytes, components of the glomerulus. Mutations in this gene are associated with focal segmental glomerulosclerosis 8. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,703,903 S52P unknown Het
Ank2 A G 3: 126,959,077 M330T possibly damaging Het
Ankar C T 1: 72,659,181 V905I possibly damaging Het
C1ql3 T C 2: 13,004,389 N215S probably damaging Het
Ccdc110 A G 8: 45,942,589 S506G probably benign Het
Ccdc87 A G 19: 4,841,147 T556A probably benign Het
Cma1 A T 14: 55,941,729 N236K probably benign Het
Csmd2 T C 4: 128,369,193 F724S Het
Cts8 T C 13: 61,253,322 K130R possibly damaging Het
Daam1 A T 12: 71,944,148 T179S unknown Het
Fancd2os T C 6: 113,597,977 T23A possibly damaging Het
Gbgt1 T A 2: 28,504,854 I168N probably damaging Het
Gckr G A 5: 31,300,024 G127D probably damaging Het
Gm11444 G A 11: 85,846,873 Q164* probably null Het
Gm28042 T A 2: 120,038,503 V526E possibly damaging Het
Gm8947 T C 1: 151,192,971 V185A possibly damaging Het
Hoxd13 C A 2: 74,668,903 H198Q possibly damaging Het
Hps6 T A 19: 46,005,508 L628* probably null Het
Igha G A 12: 113,259,139 H221Y Het
Ighm A G 12: 113,419,015 S453P Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Lfng A G 5: 140,607,773 T120A probably damaging Het
Lrrc4 C T 6: 28,662,200 A172T probably benign Het
Lrrc56 A G 7: 141,207,607 T386A probably benign Het
Mapkbp1 A T 2: 120,010,775 H81L probably benign Het
Mfsd14b C A 13: 65,073,600 V293L probably benign Het
Mrto4 T A 4: 139,349,070 N70I probably damaging Het
Mxra8 C T 4: 155,839,825 probably benign Het
Myo1h A G 5: 114,345,936 E548G Het
Ncan C T 8: 70,108,101 D739N probably benign Het
Olfr315 T C 11: 58,778,769 V214A probably benign Het
Oxgr1 T C 14: 120,022,151 T215A possibly damaging Het
Pcdhgb7 T A 18: 37,752,035 V86E probably damaging Het
Pclo G A 5: 14,712,615 V416M Het
Phf3 G T 1: 30,830,791 T392K probably benign Het
Pkhd1 A T 1: 20,566,849 V379E probably damaging Het
Ppfia3 T C 7: 45,341,115 Y1080C probably benign Het
Ptprs C A 17: 56,422,217 G1254C probably damaging Het
Qsox1 A T 1: 155,782,670 D384E probably benign Het
Rergl A G 6: 139,500,763 F23L probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Sidt2 A G 9: 45,943,614 Y588H probably damaging Het
Tas2r139 T A 6: 42,141,132 I66K probably damaging Het
Tbc1d30 T A 10: 121,272,075 D474V probably damaging Het
Tenm4 G A 7: 96,553,478 G100D probably damaging Het
Tmem258 G A 19: 10,207,273 V75I probably benign Het
Tmem91 G T 7: 25,670,563 H95N probably damaging Het
Trps1 T C 15: 50,846,694 K87E possibly damaging Het
Tspan11 T A 6: 127,943,717 M209K probably benign Het
Tspan17 C A 13: 54,793,279 Q124K probably benign Het
Uts2b G A 16: 27,360,942 R105* probably null Het
Vmn2r110 T A 17: 20,583,468 T282S probably benign Het
Xdh T A 17: 73,922,460 M333L probably benign Het
Zbtb3 A G 19: 8,804,469 E482G probably damaging Het
Other mutations in Anln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Anln APN 9 22360824 nonsense probably null
IGL01634:Anln APN 9 22360475 missense probably benign 0.00
IGL02145:Anln APN 9 22338996 splice site probably null
IGL02296:Anln APN 9 22372187 missense possibly damaging 0.67
IGL02352:Anln APN 9 22368412 missense probably benign 0.00
IGL02601:Anln APN 9 22338035 missense probably damaging 0.99
IGL02821:Anln APN 9 22358122 missense possibly damaging 0.55
IGL02863:Anln APN 9 22376365 missense probably damaging 1.00
IGL03274:Anln APN 9 22382269 missense probably damaging 1.00
R0114:Anln UTSW 9 22353346 missense probably damaging 0.99
R0486:Anln UTSW 9 22352826 missense probably benign 0.31
R0712:Anln UTSW 9 22380298 missense probably benign 0.01
R1618:Anln UTSW 9 22350918 critical splice donor site probably null
R1734:Anln UTSW 9 22350955 missense possibly damaging 0.71
R1856:Anln UTSW 9 22353331 missense probably damaging 1.00
R1999:Anln UTSW 9 22333052 makesense probably null
R2073:Anln UTSW 9 22333168 missense probably benign 0.45
R2075:Anln UTSW 9 22333168 missense probably benign 0.45
R2696:Anln UTSW 9 22360963 missense probably benign 0.08
R2943:Anln UTSW 9 22356046 splice site probably null
R4278:Anln UTSW 9 22334000 critical splice donor site probably null
R4548:Anln UTSW 9 22362888 missense possibly damaging 0.80
R4887:Anln UTSW 9 22380188 missense possibly damaging 0.46
R4979:Anln UTSW 9 22376501 missense probably benign
R5087:Anln UTSW 9 22375044 missense possibly damaging 0.61
R5197:Anln UTSW 9 22352781 critical splice donor site probably null
R5353:Anln UTSW 9 22360517 missense probably damaging 1.00
R5748:Anln UTSW 9 22337934 missense probably damaging 0.97
R5863:Anln UTSW 9 22337984 missense probably damaging 0.99
R6146:Anln UTSW 9 22376308 nonsense probably null
R6152:Anln UTSW 9 22360507 missense probably damaging 0.98
R6170:Anln UTSW 9 22368497 missense probably benign 0.01
R6261:Anln UTSW 9 22364046 missense probably damaging 1.00
R6264:Anln UTSW 9 22334117 missense possibly damaging 0.82
R6656:Anln UTSW 9 22351002 missense probably damaging 1.00
R6864:Anln UTSW 9 22382249 missense probably benign 0.36
R7514:Anln UTSW 9 22360857 missense probably damaging 0.96
R7789:Anln UTSW 9 22352037 missense
R7807:Anln UTSW 9 22360880 missense probably damaging 1.00
R7840:Anln UTSW 9 22362723 missense probably benign 0.03
R7912:Anln UTSW 9 22358669 missense possibly damaging 0.53
R8246:Anln UTSW 9 22350955 missense probably benign 0.00
R8720:Anln UTSW 9 22373277 missense probably benign 0.00
R8839:Anln UTSW 9 22356172 missense probably benign 0.02
R9054:Anln UTSW 9 22360820 critical splice donor site probably null
R9094:Anln UTSW 9 22337987 missense probably benign 0.03
R9507:Anln UTSW 9 22362840 missense probably damaging 1.00
R9683:Anln UTSW 9 22372240 nonsense probably null
R9802:Anln UTSW 9 22334157 missense probably damaging 0.99
Z1088:Anln UTSW 9 22362801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAATGATGGTGGTCTTCAAAC -3'
(R):5'- ACATCGTACTCTACTTGTGTTGTG -3'

Sequencing Primer
(F):5'- TGTCACCGAAGCACTTGG -3'
(R):5'- GGCTGATCTCAAACTAGCTGATAGC -3'
Posted On 2022-11-14