Incidental Mutation 'R9803:Tbc1d30'
ID 735325
Institutional Source Beutler Lab
Gene Symbol Tbc1d30
Ensembl Gene ENSMUSG00000052302
Gene Name TBC1 domain family, member 30
Synonyms 4930505D03Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 121099725-121187183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121107980 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 474 (D474V)
Ref Sequence ENSEMBL: ENSMUSP00000070488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064107]
AlphaFold Q69ZT9
Predicted Effect probably damaging
Transcript: ENSMUST00000064107
AA Change: D474V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070488
Gene: ENSMUSG00000052302
AA Change: D474V

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
TBC 84 318 2.22e-30 SMART
low complexity region 392 403 N/A INTRINSIC
Pfam:DUF4682 475 613 4.3e-50 PFAM
low complexity region 623 633 N/A INTRINSIC
low complexity region 649 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218111
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Tbc1d30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tbc1d30 APN 10 121,102,729 (GRCm39) utr 3 prime probably benign
IGL00837:Tbc1d30 APN 10 121,132,750 (GRCm39) missense probably damaging 1.00
IGL01081:Tbc1d30 APN 10 121,103,319 (GRCm39) missense probably damaging 1.00
IGL01813:Tbc1d30 APN 10 121,102,956 (GRCm39) missense probably benign
IGL01844:Tbc1d30 APN 10 121,103,084 (GRCm39) missense probably benign 0.01
R1782:Tbc1d30 UTSW 10 121,103,525 (GRCm39) missense probably damaging 1.00
R1972:Tbc1d30 UTSW 10 121,142,135 (GRCm39) splice site probably null
R2025:Tbc1d30 UTSW 10 121,115,051 (GRCm39) missense probably benign 0.18
R2197:Tbc1d30 UTSW 10 121,140,312 (GRCm39) missense probably damaging 1.00
R3752:Tbc1d30 UTSW 10 121,108,073 (GRCm39) missense probably damaging 1.00
R4374:Tbc1d30 UTSW 10 121,130,617 (GRCm39) missense probably damaging 1.00
R4540:Tbc1d30 UTSW 10 121,115,063 (GRCm39) missense probably damaging 0.99
R4624:Tbc1d30 UTSW 10 121,132,691 (GRCm39) missense probably damaging 0.99
R4960:Tbc1d30 UTSW 10 121,103,121 (GRCm39) missense probably benign 0.04
R5170:Tbc1d30 UTSW 10 121,142,743 (GRCm39) missense possibly damaging 0.49
R5566:Tbc1d30 UTSW 10 121,138,015 (GRCm39) missense probably damaging 1.00
R5642:Tbc1d30 UTSW 10 121,132,692 (GRCm39) missense probably damaging 1.00
R5726:Tbc1d30 UTSW 10 121,103,479 (GRCm39) missense probably damaging 1.00
R6051:Tbc1d30 UTSW 10 121,132,750 (GRCm39) missense probably damaging 1.00
R6364:Tbc1d30 UTSW 10 121,130,630 (GRCm39) missense possibly damaging 0.95
R7106:Tbc1d30 UTSW 10 121,137,897 (GRCm39) missense possibly damaging 0.94
R7233:Tbc1d30 UTSW 10 121,107,962 (GRCm39) missense probably benign 0.35
R7256:Tbc1d30 UTSW 10 121,124,870 (GRCm39) missense probably damaging 1.00
R7826:Tbc1d30 UTSW 10 121,132,710 (GRCm39) missense probably damaging 1.00
R7910:Tbc1d30 UTSW 10 121,183,061 (GRCm39) nonsense probably null
R7958:Tbc1d30 UTSW 10 121,107,962 (GRCm39) missense probably benign 0.35
R7978:Tbc1d30 UTSW 10 121,142,104 (GRCm39) missense probably damaging 1.00
R8021:Tbc1d30 UTSW 10 121,103,448 (GRCm39) missense probably benign 0.09
R8394:Tbc1d30 UTSW 10 121,183,013 (GRCm39) nonsense probably null
R8472:Tbc1d30 UTSW 10 121,187,009 (GRCm39) missense probably benign 0.00
R8532:Tbc1d30 UTSW 10 121,103,335 (GRCm39) missense probably damaging 1.00
R8887:Tbc1d30 UTSW 10 121,187,059 (GRCm39) missense possibly damaging 0.45
R9124:Tbc1d30 UTSW 10 121,132,716 (GRCm39) missense probably damaging 0.99
R9186:Tbc1d30 UTSW 10 121,111,639 (GRCm39) missense probably benign
R9282:Tbc1d30 UTSW 10 121,142,128 (GRCm39) critical splice acceptor site probably null
R9342:Tbc1d30 UTSW 10 121,103,366 (GRCm39) nonsense probably null
R9531:Tbc1d30 UTSW 10 121,183,105 (GRCm39) missense probably damaging 1.00
R9665:Tbc1d30 UTSW 10 121,102,886 (GRCm39) missense possibly damaging 0.83
R9799:Tbc1d30 UTSW 10 121,142,074 (GRCm39) missense possibly damaging 0.55
Z1176:Tbc1d30 UTSW 10 121,138,018 (GRCm39) missense probably damaging 1.00
Z1177:Tbc1d30 UTSW 10 121,186,969 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACTGGGAGCCATCCTATGAG -3'
(R):5'- TGGTTCCCATTTGCTCAGG -3'

Sequencing Primer
(F):5'- GCCATCCTATGAGACAAAGTGATCTC -3'
(R):5'- ATTTGCTCAGGTCCCCTCCG -3'
Posted On 2022-11-14