Incidental Mutation 'R9803:Ighm'
ID 735330
Institutional Source Beutler Lab
Gene Symbol Ighm
Ensembl Gene ENSMUSG00000076617
Gene Name immunoglobulin heavy constant mu
Synonyms Igh-M, Ig mu, IgM, muH, Igh6
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 113382446-113386350 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113382635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 453 (S453P)
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000103426
SMART Domains Protein: ENSMUSP00000100222
Gene: ENSMUSG00000076617

DomainStartEndE-ValueType
IG_like 23 99 1.94e-2 SMART
IGc1 131 209 2.37e-14 SMART
IG_like 241 315 1.6e-2 SMART
IGc1 348 425 1.94e-33 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000192250
Predicted Effect probably benign
Transcript: ENSMUST00000194162
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Ighm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Ighm APN 12 113,384,854 (GRCm39) unclassified probably benign
IGL01775:Ighm APN 12 113,386,087 (GRCm39) missense unknown
IGL02069:Ighm APN 12 113,384,768 (GRCm39) unclassified probably benign
IGL03124:Ighm APN 12 113,385,258 (GRCm39) missense unknown
Destiny UTSW 12 113,385,165 (GRCm39) missense
manifest UTSW 12 113,384,873 (GRCm39) nonsense probably null
G1Funyon:Ighm UTSW 12 113,385,165 (GRCm39) missense
R3055:Ighm UTSW 12 113,382,596 (GRCm39) unclassified probably benign
R3056:Ighm UTSW 12 113,382,596 (GRCm39) unclassified probably benign
R4164:Ighm UTSW 12 113,385,915 (GRCm39) missense unknown
R4475:Ighm UTSW 12 113,384,513 (GRCm39) unclassified probably benign
R4871:Ighm UTSW 12 113,385,241 (GRCm39) missense unknown
R5542:Ighm UTSW 12 113,382,601 (GRCm39) unclassified probably benign
R5738:Ighm UTSW 12 113,385,115 (GRCm39) missense unknown
R5856:Ighm UTSW 12 113,385,222 (GRCm39) missense unknown
R5946:Ighm UTSW 12 113,386,329 (GRCm39) missense unknown
R6267:Ighm UTSW 12 113,385,187 (GRCm39) missense unknown
R6296:Ighm UTSW 12 113,385,187 (GRCm39) missense unknown
R7409:Ighm UTSW 12 113,385,852 (GRCm39) missense
R7492:Ighm UTSW 12 113,386,293 (GRCm39) missense
R7898:Ighm UTSW 12 113,384,873 (GRCm39) nonsense probably null
R8089:Ighm UTSW 12 113,384,854 (GRCm39) unclassified probably benign
R8301:Ighm UTSW 12 113,385,165 (GRCm39) missense
R8444:Ighm UTSW 12 113,384,813 (GRCm39) missense
R9378:Ighm UTSW 12 113,386,210 (GRCm39) missense
R9447:Ighm UTSW 12 113,384,794 (GRCm39) missense
R9674:Ighm UTSW 12 113,385,139 (GRCm39) missense
R9733:Ighm UTSW 12 113,386,097 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACAGAGACAGTGTGAATTGC -3'
(R):5'- TTAGTGTGTCCTACAGCTTGGC -3'

Sequencing Primer
(F):5'- ACAGTGTGAATTGCTGTCCAC -3'
(R):5'- GCTTGAGCTATTAGGGGACCAGTC -3'
Posted On 2022-11-14