Incidental Mutation 'R9803:Mfsd14b'
ID 735333
Institutional Source Beutler Lab
Gene Symbol Mfsd14b
Ensembl Gene ENSMUSG00000038212
Gene Name major facilitator superfamily domain containing 14B
Synonyms 5730414C17Rik, Hiatl1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 65212844-65260813 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 65221414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 293 (V293L)
Ref Sequence ENSEMBL: ENSMUSP00000118180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054730] [ENSMUST00000155487]
AlphaFold Q8CIA9
Predicted Effect probably benign
Transcript: ENSMUST00000054730
AA Change: V293L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062566
Gene: ENSMUSG00000038212
AA Change: V293L

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.5e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155487
AA Change: V293L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118180
Gene: ENSMUSG00000038212
AA Change: V293L

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.6e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Mfsd14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Mfsd14b APN 13 65,214,515 (GRCm39) missense probably benign 0.00
IGL01935:Mfsd14b APN 13 65,215,739 (GRCm39) missense probably benign
IGL01957:Mfsd14b APN 13 65,234,907 (GRCm39) missense possibly damaging 0.90
R0555:Mfsd14b UTSW 13 65,226,259 (GRCm39) missense probably benign 0.34
R0601:Mfsd14b UTSW 13 65,234,964 (GRCm39) missense possibly damaging 0.88
R0988:Mfsd14b UTSW 13 65,260,307 (GRCm39) splice site probably benign
R1136:Mfsd14b UTSW 13 65,243,506 (GRCm39) missense probably benign 0.22
R1494:Mfsd14b UTSW 13 65,243,485 (GRCm39) missense probably damaging 1.00
R2087:Mfsd14b UTSW 13 65,215,796 (GRCm39) missense probably damaging 1.00
R4223:Mfsd14b UTSW 13 65,214,422 (GRCm39) utr 3 prime probably benign
R5103:Mfsd14b UTSW 13 65,234,907 (GRCm39) missense possibly damaging 0.56
R5568:Mfsd14b UTSW 13 65,219,936 (GRCm39) splice site probably null
R5603:Mfsd14b UTSW 13 65,221,420 (GRCm39) missense probably benign 0.00
R6181:Mfsd14b UTSW 13 65,260,398 (GRCm39) missense probably benign 0.00
R6330:Mfsd14b UTSW 13 65,243,500 (GRCm39) missense probably damaging 1.00
R6649:Mfsd14b UTSW 13 65,214,599 (GRCm39) missense probably damaging 1.00
R7460:Mfsd14b UTSW 13 65,219,837 (GRCm39) missense probably damaging 1.00
R7605:Mfsd14b UTSW 13 65,214,591 (GRCm39) missense probably benign
R9034:Mfsd14b UTSW 13 65,223,500 (GRCm39) missense probably damaging 1.00
R9268:Mfsd14b UTSW 13 65,222,855 (GRCm39) missense probably damaging 1.00
R9545:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9597:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9598:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9598:Mfsd14b UTSW 13 65,214,522 (GRCm39) missense probably benign 0.00
R9633:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9672:Mfsd14b UTSW 13 65,260,320 (GRCm39) missense probably benign 0.00
R9696:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9698:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9702:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9755:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9756:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9783:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9801:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
R9802:Mfsd14b UTSW 13 65,221,414 (GRCm39) missense probably benign 0.00
X0017:Mfsd14b UTSW 13 65,219,867 (GRCm39) missense probably benign 0.08
X0027:Mfsd14b UTSW 13 65,219,825 (GRCm39) missense probably benign 0.16
X0063:Mfsd14b UTSW 13 65,226,299 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CATCACAGCTGAGGCAACAG -3'
(R):5'- ATGCTTTCATTGTCTCCAAACTGAC -3'

Sequencing Primer
(F):5'- CACAGCTGAGGCAACAGTTTGG -3'
(R):5'- TCATTGTCTCCAAACTGACATAGAC -3'
Posted On 2022-11-14