Incidental Mutation 'R9803:Oxgr1'
ID 735335
Institutional Source Beutler Lab
Gene Symbol Oxgr1
Ensembl Gene ENSMUSG00000044819
Gene Name oxoglutarate (alpha-ketoglutarate) receptor 1
Synonyms LOC239283, Gpr99, P2Y15, Cysltr3, Gpr80
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 120019585-120042435 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120022151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 215 (T215A)
Ref Sequence ENSEMBL: ENSMUSP00000055137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058213]
AlphaFold Q6IYF8
Predicted Effect possibly damaging
Transcript: ENSMUST00000058213
AA Change: T215A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055137
Gene: ENSMUSG00000044819
AA Change: T215A

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 3.8e-35 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor (GPCR) that belongs to the oxoglutarate receptor family within the GPCR superfamily. The encoded protein is activated by the citric acid intermediate, oxoglutarate, as well as several cysteinyl leukotrienes, including leukotrienes E4, C4 and D4, which are implicated in many inflammatory disorders. In mice, a knock-out of this gene leads to middle ear inflammation, changes in the mucosal epithelium, and an increase in fluid behind the eardrum, and is associated with hearing loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced leukotriene E4 ligand (LTE4)-induced ear edema at low and intermediate doses and abnormal acid-base balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,703,903 S52P unknown Het
Ank2 A G 3: 126,959,077 M330T possibly damaging Het
Ankar C T 1: 72,659,181 V905I possibly damaging Het
Anln G T 9: 22,372,222 D438E probably damaging Het
C1ql3 T C 2: 13,004,389 N215S probably damaging Het
Ccdc110 A G 8: 45,942,589 S506G probably benign Het
Ccdc87 A G 19: 4,841,147 T556A probably benign Het
Cma1 A T 14: 55,941,729 N236K probably benign Het
Csmd2 T C 4: 128,369,193 F724S Het
Cts8 T C 13: 61,253,322 K130R possibly damaging Het
Daam1 A T 12: 71,944,148 T179S unknown Het
Fancd2os T C 6: 113,597,977 T23A possibly damaging Het
Gbgt1 T A 2: 28,504,854 I168N probably damaging Het
Gckr G A 5: 31,300,024 G127D probably damaging Het
Gm11444 G A 11: 85,846,873 Q164* probably null Het
Gm28042 T A 2: 120,038,503 V526E possibly damaging Het
Gm8947 T C 1: 151,192,971 V185A possibly damaging Het
Hoxd13 C A 2: 74,668,903 H198Q possibly damaging Het
Hps6 T A 19: 46,005,508 L628* probably null Het
Igha G A 12: 113,259,139 H221Y Het
Ighm A G 12: 113,419,015 S453P Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Lfng A G 5: 140,607,773 T120A probably damaging Het
Lrrc4 C T 6: 28,662,200 A172T probably benign Het
Lrrc56 A G 7: 141,207,607 T386A probably benign Het
Mapkbp1 A T 2: 120,010,775 H81L probably benign Het
Mfsd14b C A 13: 65,073,600 V293L probably benign Het
Mrto4 T A 4: 139,349,070 N70I probably damaging Het
Mxra8 C T 4: 155,839,825 probably benign Het
Myo1h A G 5: 114,345,936 E548G Het
Ncan C T 8: 70,108,101 D739N probably benign Het
Olfr315 T C 11: 58,778,769 V214A probably benign Het
Pcdhgb7 T A 18: 37,752,035 V86E probably damaging Het
Pclo G A 5: 14,712,615 V416M Het
Phf3 G T 1: 30,830,791 T392K probably benign Het
Pkhd1 A T 1: 20,566,849 V379E probably damaging Het
Ppfia3 T C 7: 45,341,115 Y1080C probably benign Het
Ptprs C A 17: 56,422,217 G1254C probably damaging Het
Qsox1 A T 1: 155,782,670 D384E probably benign Het
Rergl A G 6: 139,500,763 F23L probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Sidt2 A G 9: 45,943,614 Y588H probably damaging Het
Tas2r139 T A 6: 42,141,132 I66K probably damaging Het
Tbc1d30 T A 10: 121,272,075 D474V probably damaging Het
Tenm4 G A 7: 96,553,478 G100D probably damaging Het
Tmem258 G A 19: 10,207,273 V75I probably benign Het
Tmem91 G T 7: 25,670,563 H95N probably damaging Het
Trps1 T C 15: 50,846,694 K87E possibly damaging Het
Tspan11 T A 6: 127,943,717 M209K probably benign Het
Tspan17 C A 13: 54,793,279 Q124K probably benign Het
Uts2b G A 16: 27,360,942 R105* probably null Het
Vmn2r110 T A 17: 20,583,468 T282S probably benign Het
Xdh T A 17: 73,922,460 M333L probably benign Het
Zbtb3 A G 19: 8,804,469 E482G probably damaging Het
Other mutations in Oxgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Oxgr1 APN 14 120021930 missense probably damaging 0.97
IGL02678:Oxgr1 APN 14 120022168 missense probably damaging 1.00
IGL03387:Oxgr1 APN 14 120022787 nonsense probably null
IGL03394:Oxgr1 APN 14 120022610 missense possibly damaging 0.65
R1615:Oxgr1 UTSW 14 120022773 missense probably benign 0.25
R2919:Oxgr1 UTSW 14 120022809 start gained probably benign
R4223:Oxgr1 UTSW 14 120022613 missense probably damaging 1.00
R4409:Oxgr1 UTSW 14 120022160 missense possibly damaging 0.67
R4783:Oxgr1 UTSW 14 120022364 missense probably benign
R5213:Oxgr1 UTSW 14 120022140 nonsense probably null
R5226:Oxgr1 UTSW 14 120022253 missense probably damaging 1.00
R6416:Oxgr1 UTSW 14 120022448 missense probably damaging 0.99
R6491:Oxgr1 UTSW 14 120022007 missense probably benign 0.01
R6670:Oxgr1 UTSW 14 120022257 missense probably damaging 1.00
R6904:Oxgr1 UTSW 14 120022019 missense possibly damaging 0.90
R7089:Oxgr1 UTSW 14 120022202 missense probably damaging 1.00
R7819:Oxgr1 UTSW 14 120022869 critical splice acceptor site probably null
R9672:Oxgr1 UTSW 14 120022042 missense probably damaging 1.00
R9731:Oxgr1 UTSW 14 120022682 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCGATGGAGCAGCTGATTG -3'
(R):5'- TTCAGAAAACTCGCTGGGCAG -3'

Sequencing Primer
(F):5'- CTGATTGAAAGCAGGCGAGATTC -3'
(R):5'- AACTCGCTGGGCAGTGGTAG -3'
Posted On 2022-11-14