Incidental Mutation 'R9803:Trps1'
ID 735336
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Name transcriptional repressor GATA binding 1
Synonyms D15Ertd586e, trichorhinophalangeal syndrome I (human)
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 50518148-50753859 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50710090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 87 (K87E)
Ref Sequence ENSEMBL: ENSMUSP00000139017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885] [ENSMUST00000185183]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000077935
AA Change: K83E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: K83E

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165201
AA Change: K83E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: K83E

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183757
AA Change: K87E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: K87E

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183997
AA Change: K87E

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: K87E

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184458
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184885
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185183
AA Change: K83E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138967
Gene: ENSMUSG00000038679
AA Change: K83E

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50,710,266 (GRCm39) missense probably benign 0.07
IGL00497:Trps1 APN 15 50,524,703 (GRCm39) missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50,524,481 (GRCm39) missense probably damaging 1.00
IGL01325:Trps1 APN 15 50,710,210 (GRCm39) missense probably benign 0.40
IGL02132:Trps1 APN 15 50,685,674 (GRCm39) missense probably damaging 1.00
IGL02631:Trps1 APN 15 50,709,417 (GRCm39) missense probably damaging 1.00
IGL02740:Trps1 APN 15 50,709,935 (GRCm39) missense probably damaging 1.00
IGL02821:Trps1 APN 15 50,524,273 (GRCm39) missense probably damaging 1.00
IGL03096:Trps1 APN 15 50,709,875 (GRCm39) missense probably benign
F5770:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
R0050:Trps1 UTSW 15 50,628,921 (GRCm39) missense probably benign 0.18
R0244:Trps1 UTSW 15 50,528,139 (GRCm39) missense probably damaging 1.00
R0377:Trps1 UTSW 15 50,695,174 (GRCm39) nonsense probably null
R0599:Trps1 UTSW 15 50,695,256 (GRCm39) nonsense probably null
R0848:Trps1 UTSW 15 50,524,945 (GRCm39) missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50,524,609 (GRCm39) missense probably damaging 1.00
R1830:Trps1 UTSW 15 50,524,532 (GRCm39) missense probably damaging 0.99
R2083:Trps1 UTSW 15 50,685,701 (GRCm39) missense probably damaging 1.00
R2167:Trps1 UTSW 15 50,695,126 (GRCm39) missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50,685,794 (GRCm39) missense probably damaging 1.00
R2314:Trps1 UTSW 15 50,524,742 (GRCm39) missense probably damaging 1.00
R3735:Trps1 UTSW 15 50,709,456 (GRCm39) missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50,694,783 (GRCm39) missense probably damaging 1.00
R4223:Trps1 UTSW 15 50,710,044 (GRCm39) missense probably benign
R4280:Trps1 UTSW 15 50,709,478 (GRCm39) missense probably benign 0.00
R4566:Trps1 UTSW 15 50,695,074 (GRCm39) missense probably damaging 1.00
R4810:Trps1 UTSW 15 50,685,692 (GRCm39) missense probably benign 0.14
R4828:Trps1 UTSW 15 50,524,073 (GRCm39) makesense probably null
R4838:Trps1 UTSW 15 50,690,712 (GRCm39) missense probably benign 0.05
R4852:Trps1 UTSW 15 50,709,705 (GRCm39) missense probably damaging 1.00
R5001:Trps1 UTSW 15 50,524,703 (GRCm39) missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50,528,156 (GRCm39) missense probably damaging 1.00
R5463:Trps1 UTSW 15 50,695,286 (GRCm39) nonsense probably null
R5677:Trps1 UTSW 15 50,709,504 (GRCm39) missense probably damaging 1.00
R5691:Trps1 UTSW 15 50,690,700 (GRCm39) missense probably benign
R6432:Trps1 UTSW 15 50,694,793 (GRCm39) missense probably damaging 0.96
R6528:Trps1 UTSW 15 50,685,823 (GRCm39) missense probably benign 0.01
R6594:Trps1 UTSW 15 50,694,351 (GRCm39) missense probably damaging 0.99
R6827:Trps1 UTSW 15 50,685,959 (GRCm39) missense probably benign 0.14
R6862:Trps1 UTSW 15 50,695,001 (GRCm39) critical splice donor site probably null
R6912:Trps1 UTSW 15 50,685,694 (GRCm39) missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50,685,793 (GRCm39) missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50,695,273 (GRCm39) missense probably damaging 0.99
R7857:Trps1 UTSW 15 50,524,401 (GRCm39) missense probably damaging 1.00
R7986:Trps1 UTSW 15 50,753,019 (GRCm39) missense probably benign 0.00
R7986:Trps1 UTSW 15 50,525,132 (GRCm39) missense probably damaging 1.00
R8744:Trps1 UTSW 15 50,524,642 (GRCm39) missense probably damaging 1.00
R8838:Trps1 UTSW 15 50,753,007 (GRCm39) missense probably benign 0.01
R8859:Trps1 UTSW 15 50,685,769 (GRCm39) missense possibly damaging 0.77
R8935:Trps1 UTSW 15 50,752,344 (GRCm39) nonsense probably null
R9044:Trps1 UTSW 15 50,686,003 (GRCm39) missense probably benign 0.11
R9142:Trps1 UTSW 15 50,524,658 (GRCm39) missense probably damaging 0.98
R9211:Trps1 UTSW 15 50,694,840 (GRCm39) missense probably damaging 1.00
R9283:Trps1 UTSW 15 50,694,447 (GRCm39) missense probably damaging 1.00
R9363:Trps1 UTSW 15 50,524,676 (GRCm39) missense probably damaging 1.00
R9402:Trps1 UTSW 15 50,709,652 (GRCm39) missense probably damaging 1.00
R9562:Trps1 UTSW 15 50,524,657 (GRCm39) missense probably damaging 1.00
R9647:Trps1 UTSW 15 50,524,944 (GRCm39) missense probably benign 0.09
V7580:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
V7581:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
V7583:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATATCTTGAGGGTCATCTG -3'
(R):5'- CCCTCTGAGAAACGTTGCTAG -3'

Sequencing Primer
(F):5'- TGAGGGTCATCTGCCTCTGC -3'
(R):5'- CCTCTGAGAAACGTTGCTAGTGAAG -3'
Posted On 2022-11-14