Mutagenetix > Incidental Mutation

Incidental Mutation 'R9803:Trps1'

735336

Institutional Source

Beutler Lab

Gene Symbol

Trps1

Ensembl Gene

ENSMUSG00000038679

Gene Name

transcriptional repressor GATA binding 1

Synonyms

D15Ertd586e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9803 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

50654752-50890463 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50846694 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 87 (K87E)

Ref Sequence

ENSEMBL: ENSMUSP00000139017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885] [ENSMUST00000185183]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077935
AA Change: K83E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: K83E

Domain	Start	End	E-Value	Type
ZnF_C2H2	222	247	1.41e0	SMART
ZnF_C2H2	333	358	4.45e0	SMART
ZnF_C2H2	434	459	1.31e2	SMART
ZnF_C2H2	523	554	1.93e2	SMART
low complexity region	597	602	N/A	INTRINSIC
ZnF_C2H2	614	637	8.67e-1	SMART
ZnF_C2H2	666	689	2.29e0	SMART
ZnF_C2H2	692	715	8.22e-2	SMART
low complexity region	766	779	N/A	INTRINSIC
ZnF_GATA	890	940	3.95e-16	SMART
low complexity region	1050	1062	N/A	INTRINSIC
ZnF_C2H2	1215	1237	4.34e0	SMART
ZnF_C2H2	1243	1267	5.72e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165201
AA Change: K83E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: K83E

Domain	Start	End	E-Value	Type
ZnF_C2H2	222	247	1.41e0	SMART
ZnF_C2H2	333	358	4.45e0	SMART
ZnF_C2H2	434	459	1.31e2	SMART
ZnF_C2H2	523	554	1.93e2	SMART
low complexity region	597	602	N/A	INTRINSIC
ZnF_C2H2	614	637	8.67e-1	SMART
ZnF_C2H2	666	689	2.29e0	SMART
ZnF_C2H2	692	715	8.22e-2	SMART
low complexity region	766	779	N/A	INTRINSIC
ZnF_GATA	890	940	3.95e-16	SMART
low complexity region	1050	1062	N/A	INTRINSIC
ZnF_C2H2	1215	1237	4.34e0	SMART
ZnF_C2H2	1243	1267	5.72e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000183757
AA Change: K87E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: K87E

Domain	Start	End	E-Value	Type
ZnF_C2H2	226	251	1.41e0	SMART
ZnF_C2H2	337	362	4.45e0	SMART
ZnF_C2H2	438	463	1.31e2	SMART
ZnF_C2H2	527	558	1.93e2	SMART
low complexity region	601	606	N/A	INTRINSIC
ZnF_C2H2	618	641	8.67e-1	SMART
ZnF_C2H2	670	693	2.29e0	SMART
ZnF_C2H2	696	719	8.22e-2	SMART
low complexity region	770	783	N/A	INTRINSIC
ZnF_GATA	894	944	3.95e-16	SMART
low complexity region	1054	1066	N/A	INTRINSIC
ZnF_C2H2	1219	1241	4.34e0	SMART
ZnF_C2H2	1247	1271	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183997
AA Change: K87E

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: K87E

Domain	Start	End	E-Value	Type
ZnF_C2H2	226	251	1.41e0	SMART
ZnF_C2H2	337	362	4.45e0	SMART
ZnF_C2H2	470	493	2.29e0	SMART
ZnF_C2H2	496	519	8.22e-2	SMART
low complexity region	570	583	N/A	INTRINSIC
ZnF_GATA	705	755	3.95e-16	SMART
low complexity region	865	877	N/A	INTRINSIC
ZnF_C2H2	1030	1052	4.34e0	SMART
ZnF_C2H2	1058	1082	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184458

SMART Domains

Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679

Domain	Start	End	E-Value	Type
ZnF_C2H2	46	71	4.45e0	SMART
ZnF_C2H2	147	172	1.31e2	SMART
ZnF_C2H2	236	267	1.93e2	SMART
low complexity region	310	315	N/A	INTRINSIC
ZnF_C2H2	327	350	8.67e-1	SMART
ZnF_C2H2	379	402	2.29e0	SMART
ZnF_C2H2	405	428	8.22e-2	SMART
low complexity region	479	492	N/A	INTRINSIC
ZnF_GATA	603	653	3.95e-16	SMART
low complexity region	763	775	N/A	INTRINSIC
ZnF_C2H2	928	950	4.34e0	SMART
ZnF_C2H2	956	980	5.72e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184885

SMART Domains

Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679

Domain	Start	End	E-Value	Type
ZnF_C2H2	176	201	1.41e0	SMART
ZnF_C2H2	287	312	4.45e0	SMART
ZnF_C2H2	420	443	2.29e0	SMART
ZnF_C2H2	446	469	8.22e-2	SMART
low complexity region	520	533	N/A	INTRINSIC
ZnF_GATA	644	694	3.95e-16	SMART
low complexity region	804	816	N/A	INTRINSIC
ZnF_C2H2	969	991	4.34e0	SMART
ZnF_C2H2	997	1021	5.72e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185183
AA Change: K83E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000138967
Gene: ENSMUSG00000038679
AA Change: K83E

Domain	Start	End	E-Value	Type
ZnF_C2H2	222	247	1.41e0	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	G	5: 113,703,903	S52P	unknown	Het
Ank2	A	G	3: 126,959,077	M330T	possibly damaging	Het
Ankar	C	T	1: 72,659,181	V905I	possibly damaging	Het
Anln	G	T	9: 22,372,222	D438E	probably damaging	Het
C1ql3	T	C	2: 13,004,389	N215S	probably damaging	Het
Ccdc110	A	G	8: 45,942,589	S506G	probably benign	Het
Ccdc87	A	G	19: 4,841,147	T556A	probably benign	Het
Cma1	A	T	14: 55,941,729	N236K	probably benign	Het
Csmd2	T	C	4: 128,369,193	F724S		Het
Cts8	T	C	13: 61,253,322	K130R	possibly damaging	Het
Daam1	A	T	12: 71,944,148	T179S	unknown	Het
Fancd2os	T	C	6: 113,597,977	T23A	possibly damaging	Het
Gbgt1	T	A	2: 28,504,854	I168N	probably damaging	Het
Gckr	G	A	5: 31,300,024	G127D	probably damaging	Het
Gm11444	G	A	11: 85,846,873	Q164*	probably null	Het
Gm28042	T	A	2: 120,038,503	V526E	possibly damaging	Het
Gm8947	T	C	1: 151,192,971	V185A	possibly damaging	Het
Hoxd13	C	A	2: 74,668,903	H198Q	possibly damaging	Het
Hps6	T	A	19: 46,005,508	L628*	probably null	Het
Igha	G	A	12: 113,259,139	H221Y		Het
Ighm	A	G	12: 113,419,015	S453P		Het
Inpp5f	A	C	7: 128,676,791	D435A	possibly damaging	Het
Lfng	A	G	5: 140,607,773	T120A	probably damaging	Het
Lrrc4	C	T	6: 28,662,200	A172T	probably benign	Het
Lrrc56	A	G	7: 141,207,607	T386A	probably benign	Het
Mapkbp1	A	T	2: 120,010,775	H81L	probably benign	Het
Mfsd14b	C	A	13: 65,073,600	V293L	probably benign	Het
Mrto4	T	A	4: 139,349,070	N70I	probably damaging	Het
Mxra8	C	T	4: 155,839,825		probably benign	Het
Myo1h	A	G	5: 114,345,936	E548G		Het
Ncan	C	T	8: 70,108,101	D739N	probably benign	Het
Olfr315	T	C	11: 58,778,769	V214A	probably benign	Het
Oxgr1	T	C	14: 120,022,151	T215A	possibly damaging	Het
Pcdhgb7	T	A	18: 37,752,035	V86E	probably damaging	Het
Pclo	G	A	5: 14,712,615	V416M		Het
Phf3	G	T	1: 30,830,791	T392K	probably benign	Het
Pkhd1	A	T	1: 20,566,849	V379E	probably damaging	Het
Ppfia3	T	C	7: 45,341,115	Y1080C	probably benign	Het
Ptprs	C	A	17: 56,422,217	G1254C	probably damaging	Het
Qsox1	A	T	1: 155,782,670	D384E	probably benign	Het
Rergl	A	G	6: 139,500,763	F23L	probably damaging	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Sidt2	A	G	9: 45,943,614	Y588H	probably damaging	Het
Tas2r139	T	A	6: 42,141,132	I66K	probably damaging	Het
Tbc1d30	T	A	10: 121,272,075	D474V	probably damaging	Het
Tenm4	G	A	7: 96,553,478	G100D	probably damaging	Het
Tmem258	G	A	19: 10,207,273	V75I	probably benign	Het
Tmem91	G	T	7: 25,670,563	H95N	probably damaging	Het
Tspan11	T	A	6: 127,943,717	M209K	probably benign	Het
Tspan17	C	A	13: 54,793,279	Q124K	probably benign	Het
Uts2b	G	A	16: 27,360,942	R105*	probably null	Het
Vmn2r110	T	A	17: 20,583,468	T282S	probably benign	Het
Xdh	T	A	17: 73,922,460	M333L	probably benign	Het
Zbtb3	A	G	19: 8,804,469	E482G	probably damaging	Het

Other mutations in Trps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Trps1	APN	15	50846870	missense	probably benign	0.07
IGL00497:Trps1	APN	15	50661307	missense	possibly damaging	0.91
IGL00558:Trps1	APN	15	50661085	missense	probably damaging	1.00
IGL01325:Trps1	APN	15	50846814	missense	probably benign	0.40
IGL02132:Trps1	APN	15	50822278	missense	probably damaging	1.00
IGL02631:Trps1	APN	15	50846021	missense	probably damaging	1.00
IGL02740:Trps1	APN	15	50846539	missense	probably damaging	1.00
IGL02821:Trps1	APN	15	50660877	missense	probably damaging	1.00
IGL03096:Trps1	APN	15	50846479	missense	probably benign
F5770:Trps1	UTSW	15	50831577	missense	probably damaging	1.00
R0050:Trps1	UTSW	15	50765525	missense	probably benign	0.18
R0244:Trps1	UTSW	15	50664743	missense	probably damaging	1.00
R0377:Trps1	UTSW	15	50831778	nonsense	probably null
R0599:Trps1	UTSW	15	50831860	nonsense	probably null
R0848:Trps1	UTSW	15	50661549	missense	possibly damaging	0.54
R1744:Trps1	UTSW	15	50661213	missense	probably damaging	1.00
R1830:Trps1	UTSW	15	50661136	missense	probably damaging	0.99
R2083:Trps1	UTSW	15	50822305	missense	probably damaging	1.00
R2167:Trps1	UTSW	15	50831730	missense	possibly damaging	0.94
R2267:Trps1	UTSW	15	50822398	missense	probably damaging	1.00
R2314:Trps1	UTSW	15	50661346	missense	probably damaging	1.00
R3735:Trps1	UTSW	15	50846060	missense	possibly damaging	0.94
R4133:Trps1	UTSW	15	50831387	missense	probably damaging	1.00
R4223:Trps1	UTSW	15	50846648	missense	probably benign
R4280:Trps1	UTSW	15	50846082	missense	probably benign	0.00
R4566:Trps1	UTSW	15	50831678	missense	probably damaging	1.00
R4810:Trps1	UTSW	15	50822296	missense	probably benign	0.14
R4828:Trps1	UTSW	15	50660677	makesense	probably null
R4838:Trps1	UTSW	15	50827316	missense	probably benign	0.05
R4852:Trps1	UTSW	15	50846309	missense	probably damaging	1.00
R5001:Trps1	UTSW	15	50661307	missense	possibly damaging	0.91
R5311:Trps1	UTSW	15	50664760	missense	probably damaging	1.00
R5463:Trps1	UTSW	15	50831890	nonsense	probably null
R5677:Trps1	UTSW	15	50846108	missense	probably damaging	1.00
R5691:Trps1	UTSW	15	50827304	missense	probably benign
R6432:Trps1	UTSW	15	50831397	missense	probably damaging	0.96
R6528:Trps1	UTSW	15	50822427	missense	probably benign	0.01
R6594:Trps1	UTSW	15	50830955	missense	probably damaging	0.99
R6827:Trps1	UTSW	15	50822563	missense	probably benign	0.14
R6862:Trps1	UTSW	15	50831605	critical splice donor site	probably null
R6912:Trps1	UTSW	15	50822298	missense	possibly damaging	0.92
R7151:Trps1	UTSW	15	50822397	missense	possibly damaging	0.95
R7846:Trps1	UTSW	15	50831877	missense	probably damaging	0.99
R7857:Trps1	UTSW	15	50661005	missense	probably damaging	1.00
R7986:Trps1	UTSW	15	50661736	missense	probably damaging	1.00
R7986:Trps1	UTSW	15	50889623	missense	probably benign	0.00
R8744:Trps1	UTSW	15	50661246	missense	probably damaging	1.00
R8838:Trps1	UTSW	15	50889611	missense	probably benign	0.01
R8859:Trps1	UTSW	15	50822373	missense	possibly damaging	0.77
R8935:Trps1	UTSW	15	50888948	nonsense	probably null
R9044:Trps1	UTSW	15	50822607	missense	probably benign	0.11
R9142:Trps1	UTSW	15	50661262	missense	probably damaging	0.98
R9211:Trps1	UTSW	15	50831444	missense	probably damaging	1.00
R9283:Trps1	UTSW	15	50831051	missense	probably damaging	1.00
R9363:Trps1	UTSW	15	50661280	missense	probably damaging	1.00
R9402:Trps1	UTSW	15	50846256	missense	probably damaging	1.00
R9562:Trps1	UTSW	15	50661261	missense	probably damaging	1.00
R9647:Trps1	UTSW	15	50661548	missense	probably benign	0.09
V7580:Trps1	UTSW	15	50831577	missense	probably damaging	1.00
V7581:Trps1	UTSW	15	50831577	missense	probably damaging	1.00
V7583:Trps1	UTSW	15	50831577	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCATATCTTGAGGGTCATCTG -3'
(R):5'- CCCTCTGAGAAACGTTGCTAG -3'

Sequencing Primer
(F):5'- TGAGGGTCATCTGCCTCTGC -3'
(R):5'- CCTCTGAGAAACGTTGCTAGTGAAG -3'

Posted On

2022-11-14