Incidental Mutation 'R9803:Vmn2r110'
ID 735338
Institutional Source Beutler Lab
Gene Symbol Vmn2r110
Ensembl Gene ENSMUSG00000091259
Gene Name vomeronasal 2, receptor 110
Synonyms EG224582
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20573829-20596259 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20583468 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 282 (T282S)
Ref Sequence ENSEMBL: ENSMUSP00000129347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169559]
AlphaFold E9PWD5
Predicted Effect probably benign
Transcript: ENSMUST00000169559
AA Change: T282S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129347
Gene: ENSMUSG00000091259
AA Change: T282S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 83 467 3.1e-33 PFAM
Pfam:NCD3G 510 563 5.2e-22 PFAM
Pfam:7tm_3 594 831 4.2e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,703,903 S52P unknown Het
Ank2 A G 3: 126,959,077 M330T possibly damaging Het
Ankar C T 1: 72,659,181 V905I possibly damaging Het
Anln G T 9: 22,372,222 D438E probably damaging Het
C1ql3 T C 2: 13,004,389 N215S probably damaging Het
Ccdc110 A G 8: 45,942,589 S506G probably benign Het
Ccdc87 A G 19: 4,841,147 T556A probably benign Het
Cma1 A T 14: 55,941,729 N236K probably benign Het
Csmd2 T C 4: 128,369,193 F724S Het
Cts8 T C 13: 61,253,322 K130R possibly damaging Het
Daam1 A T 12: 71,944,148 T179S unknown Het
Fancd2os T C 6: 113,597,977 T23A possibly damaging Het
Gbgt1 T A 2: 28,504,854 I168N probably damaging Het
Gckr G A 5: 31,300,024 G127D probably damaging Het
Gm11444 G A 11: 85,846,873 Q164* probably null Het
Gm28042 T A 2: 120,038,503 V526E possibly damaging Het
Gm8947 T C 1: 151,192,971 V185A possibly damaging Het
Hoxd13 C A 2: 74,668,903 H198Q possibly damaging Het
Hps6 T A 19: 46,005,508 L628* probably null Het
Igha G A 12: 113,259,139 H221Y Het
Ighm A G 12: 113,419,015 S453P Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Lfng A G 5: 140,607,773 T120A probably damaging Het
Lrrc4 C T 6: 28,662,200 A172T probably benign Het
Lrrc56 A G 7: 141,207,607 T386A probably benign Het
Mapkbp1 A T 2: 120,010,775 H81L probably benign Het
Mfsd14b C A 13: 65,073,600 V293L probably benign Het
Mrto4 T A 4: 139,349,070 N70I probably damaging Het
Mxra8 C T 4: 155,839,825 probably benign Het
Myo1h A G 5: 114,345,936 E548G Het
Ncan C T 8: 70,108,101 D739N probably benign Het
Olfr315 T C 11: 58,778,769 V214A probably benign Het
Oxgr1 T C 14: 120,022,151 T215A possibly damaging Het
Pcdhgb7 T A 18: 37,752,035 V86E probably damaging Het
Pclo G A 5: 14,712,615 V416M Het
Phf3 G T 1: 30,830,791 T392K probably benign Het
Pkhd1 A T 1: 20,566,849 V379E probably damaging Het
Ppfia3 T C 7: 45,341,115 Y1080C probably benign Het
Ptprs C A 17: 56,422,217 G1254C probably damaging Het
Qsox1 A T 1: 155,782,670 D384E probably benign Het
Rergl A G 6: 139,500,763 F23L probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Sidt2 A G 9: 45,943,614 Y588H probably damaging Het
Tas2r139 T A 6: 42,141,132 I66K probably damaging Het
Tbc1d30 T A 10: 121,272,075 D474V probably damaging Het
Tenm4 G A 7: 96,553,478 G100D probably damaging Het
Tmem258 G A 19: 10,207,273 V75I probably benign Het
Tmem91 G T 7: 25,670,563 H95N probably damaging Het
Trps1 T C 15: 50,846,694 K87E possibly damaging Het
Tspan11 T A 6: 127,943,717 M209K probably benign Het
Tspan17 C A 13: 54,793,279 Q124K probably benign Het
Uts2b G A 16: 27,360,942 R105* probably null Het
Xdh T A 17: 73,922,460 M333L probably benign Het
Zbtb3 A G 19: 8,804,469 E482G probably damaging Het
Other mutations in Vmn2r110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01774:Vmn2r110 APN 17 20583627 missense probably benign 0.01
IGL01824:Vmn2r110 APN 17 20574667 missense probably benign 0.44
IGL01879:Vmn2r110 APN 17 20573860 missense probably benign 0.01
IGL02168:Vmn2r110 APN 17 20583800 splice site probably benign
IGL02178:Vmn2r110 APN 17 20584444 splice site probably null
IGL02322:Vmn2r110 APN 17 20573935 missense probably damaging 1.00
IGL02323:Vmn2r110 APN 17 20596137 missense probably damaging 0.98
IGL02415:Vmn2r110 APN 17 20583771 missense probably benign 0.03
IGL02491:Vmn2r110 APN 17 20596138 missense probably damaging 0.99
IGL02876:Vmn2r110 APN 17 20574296 missense probably damaging 0.98
IGL03141:Vmn2r110 APN 17 20583714 missense possibly damaging 0.79
IGL03270:Vmn2r110 APN 17 20583516 missense probably benign 0.00
IGL03286:Vmn2r110 APN 17 20584206 missense possibly damaging 0.95
IGL03379:Vmn2r110 APN 17 20583644 missense probably damaging 0.99
PIT4243001:Vmn2r110 UTSW 17 20582117 missense probably benign 0.01
R0040:Vmn2r110 UTSW 17 20596084 missense probably benign 0.10
R0195:Vmn2r110 UTSW 17 20574055 missense probably benign 0.31
R0716:Vmn2r110 UTSW 17 20573903 missense probably damaging 0.99
R1199:Vmn2r110 UTSW 17 20583263 missense probably benign 0.03
R1767:Vmn2r110 UTSW 17 20580578 missense possibly damaging 0.83
R2212:Vmn2r110 UTSW 17 20573947 splice site probably null
R3056:Vmn2r110 UTSW 17 20583098 missense probably damaging 1.00
R4093:Vmn2r110 UTSW 17 20583380 missense possibly damaging 0.83
R4418:Vmn2r110 UTSW 17 20583689 nonsense probably null
R4598:Vmn2r110 UTSW 17 20583767 nonsense probably null
R4754:Vmn2r110 UTSW 17 20596196 missense probably benign 0.00
R5283:Vmn2r110 UTSW 17 20580637 missense probably benign 0.00
R5421:Vmn2r110 UTSW 17 20583620 missense probably damaging 1.00
R5672:Vmn2r110 UTSW 17 20596232 missense probably benign
R5865:Vmn2r110 UTSW 17 20584295 missense probably benign 0.00
R6642:Vmn2r110 UTSW 17 20583517 missense possibly damaging 0.94
R6799:Vmn2r110 UTSW 17 20583536 missense probably benign
R7167:Vmn2r110 UTSW 17 20574179 missense probably benign 0.01
R7291:Vmn2r110 UTSW 17 20574209 missense probably benign 0.13
R7320:Vmn2r110 UTSW 17 20596054 missense probably benign
R7519:Vmn2r110 UTSW 17 20584262 missense probably benign
R8089:Vmn2r110 UTSW 17 20583545 missense probably benign 0.00
R8234:Vmn2r110 UTSW 17 20584429 missense probably benign 0.12
R8272:Vmn2r110 UTSW 17 20596228 missense probably damaging 0.97
R8307:Vmn2r110 UTSW 17 20583057 missense probably benign 0.00
R8506:Vmn2r110 UTSW 17 20584365 missense probably benign 0.00
R8516:Vmn2r110 UTSW 17 20574613 missense probably damaging 1.00
R8555:Vmn2r110 UTSW 17 20584356 missense probably damaging 0.97
R8691:Vmn2r110 UTSW 17 20583142 missense probably benign 0.19
R8859:Vmn2r110 UTSW 17 20574298 missense probably damaging 0.99
R8935:Vmn2r110 UTSW 17 20583695 missense probably benign 0.40
R8986:Vmn2r110 UTSW 17 20583561 missense probably damaging 0.97
R9012:Vmn2r110 UTSW 17 20583365 missense probably damaging 1.00
R9101:Vmn2r110 UTSW 17 20574209 missense
R9744:Vmn2r110 UTSW 17 20574586 missense probably damaging 0.98
Z1088:Vmn2r110 UTSW 17 20583680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGAAGGTAAATGTCTTCAGGG -3'
(R):5'- TCCCAGATGACCACAAAGGG -3'

Sequencing Primer
(F):5'- AAATGTCTTCAGGGTATTTGTAAGG -3'
(R):5'- AGGAGTCTGCATAGCTTT -3'
Posted On 2022-11-14