Mutagenetix > Incidental Mutation

Incidental Mutation 'R9803:Xdh'

735340

Institutional Source

Beutler Lab

Gene Symbol

Xdh

Ensembl Gene

ENSMUSG00000024066

Gene Name

xanthine dehydrogenase

Synonyms

xanthine oxidase, XO, Xor, Xox1, Xox-1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R9803 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73883908-73950182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73922460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 333 (M333L)

Ref Sequence

ENSEMBL: ENSMUSP00000024866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024866]

AlphaFold

Q00519

Predicted Effect

probably benign
Transcript: ENSMUST00000024866
AA Change: M333L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: M333L

Domain	Start	End	E-Value	Type
Pfam:Fer2	11	81	5e-12	PFAM
Pfam:Fer2_2	90	163	4.1e-31	PFAM
low complexity region	169	182	N/A	INTRINSIC
Pfam:FAD_binding_5	234	414	4.9e-47	PFAM
CO_deh_flav_C	421	525	1.16e-24	SMART
Ald_Xan_dh_C	590	696	1.23e-46	SMART
Pfam:Ald_Xan_dh_C2	704	1239	1e-200	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	G	5: 113,703,903	S52P	unknown	Het
Ank2	A	G	3: 126,959,077	M330T	possibly damaging	Het
Ankar	C	T	1: 72,659,181	V905I	possibly damaging	Het
Anln	G	T	9: 22,372,222	D438E	probably damaging	Het
C1ql3	T	C	2: 13,004,389	N215S	probably damaging	Het
Ccdc110	A	G	8: 45,942,589	S506G	probably benign	Het
Ccdc87	A	G	19: 4,841,147	T556A	probably benign	Het
Cma1	A	T	14: 55,941,729	N236K	probably benign	Het
Csmd2	T	C	4: 128,369,193	F724S		Het
Cts8	T	C	13: 61,253,322	K130R	possibly damaging	Het
Daam1	A	T	12: 71,944,148	T179S	unknown	Het
Fancd2os	T	C	6: 113,597,977	T23A	possibly damaging	Het
Gbgt1	T	A	2: 28,504,854	I168N	probably damaging	Het
Gckr	G	A	5: 31,300,024	G127D	probably damaging	Het
Gm11444	G	A	11: 85,846,873	Q164*	probably null	Het
Gm28042	T	A	2: 120,038,503	V526E	possibly damaging	Het
Gm8947	T	C	1: 151,192,971	V185A	possibly damaging	Het
Hoxd13	C	A	2: 74,668,903	H198Q	possibly damaging	Het
Hps6	T	A	19: 46,005,508	L628*	probably null	Het
Igha	G	A	12: 113,259,139	H221Y		Het
Ighm	A	G	12: 113,419,015	S453P		Het
Inpp5f	A	C	7: 128,676,791	D435A	possibly damaging	Het
Lfng	A	G	5: 140,607,773	T120A	probably damaging	Het
Lrrc4	C	T	6: 28,662,200	A172T	probably benign	Het
Lrrc56	A	G	7: 141,207,607	T386A	probably benign	Het
Mapkbp1	A	T	2: 120,010,775	H81L	probably benign	Het
Mfsd14b	C	A	13: 65,073,600	V293L	probably benign	Het
Mrto4	T	A	4: 139,349,070	N70I	probably damaging	Het
Mxra8	C	T	4: 155,839,825		probably benign	Het
Myo1h	A	G	5: 114,345,936	E548G		Het
Ncan	C	T	8: 70,108,101	D739N	probably benign	Het
Olfr315	T	C	11: 58,778,769	V214A	probably benign	Het
Oxgr1	T	C	14: 120,022,151	T215A	possibly damaging	Het
Pcdhgb7	T	A	18: 37,752,035	V86E	probably damaging	Het
Pclo	G	A	5: 14,712,615	V416M		Het
Phf3	G	T	1: 30,830,791	T392K	probably benign	Het
Pkhd1	A	T	1: 20,566,849	V379E	probably damaging	Het
Ppfia3	T	C	7: 45,341,115	Y1080C	probably benign	Het
Ptprs	C	A	17: 56,422,217	G1254C	probably damaging	Het
Qsox1	A	T	1: 155,782,670	D384E	probably benign	Het
Rergl	A	G	6: 139,500,763	F23L	probably damaging	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Sidt2	A	G	9: 45,943,614	Y588H	probably damaging	Het
Tas2r139	T	A	6: 42,141,132	I66K	probably damaging	Het
Tbc1d30	T	A	10: 121,272,075	D474V	probably damaging	Het
Tenm4	G	A	7: 96,553,478	G100D	probably damaging	Het
Tmem258	G	A	19: 10,207,273	V75I	probably benign	Het
Tmem91	G	T	7: 25,670,563	H95N	probably damaging	Het
Trps1	T	C	15: 50,846,694	K87E	possibly damaging	Het
Tspan11	T	A	6: 127,943,717	M209K	probably benign	Het
Tspan17	C	A	13: 54,793,279	Q124K	probably benign	Het
Uts2b	G	A	16: 27,360,942	R105*	probably null	Het
Vmn2r110	T	A	17: 20,583,468	T282S	probably benign	Het
Zbtb3	A	G	19: 8,804,469	E482G	probably damaging	Het

Other mutations in Xdh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Xdh	APN	17	73923106	missense	possibly damaging	0.58
IGL00556:Xdh	APN	17	73884435	makesense	probably null
IGL01524:Xdh	APN	17	73923137	critical splice acceptor site	probably null
IGL01604:Xdh	APN	17	73909337	missense	probably benign	0.02
IGL01625:Xdh	APN	17	73916786	critical splice donor site	probably null
IGL01778:Xdh	APN	17	73900280	missense	probably benign	0.00
IGL01804:Xdh	APN	17	73892759	missense	probably damaging	1.00
IGL01825:Xdh	APN	17	73891245	missense	probably damaging	1.00
IGL01929:Xdh	APN	17	73934855	missense	probably damaging	1.00
IGL02068:Xdh	APN	17	73913950	missense	probably damaging	1.00
IGL02079:Xdh	APN	17	73891277	missense	probably damaging	1.00
IGL02210:Xdh	APN	17	73943895	missense	probably benign	0.00
IGL02261:Xdh	APN	17	73913965	missense	possibly damaging	0.81
IGL02365:Xdh	APN	17	73943890	missense	probably benign	0.14
IGL02424:Xdh	APN	17	73926570	missense	probably benign	0.00
IGL02491:Xdh	APN	17	73886464	missense	probably damaging	0.99
IGL02525:Xdh	APN	17	73924995	missense	possibly damaging	0.91
IGL02578:Xdh	APN	17	73906246	missense	probably damaging	1.00
IGL02793:Xdh	APN	17	73900581	missense	probably damaging	1.00
IGL02939:Xdh	APN	17	73943845	critical splice donor site	probably null
IGL03327:Xdh	APN	17	73916792	missense	probably benign
IGL03345:Xdh	APN	17	73906032	missense	probably damaging	0.98
IGL03353:Xdh	APN	17	73895786	missense	possibly damaging	0.65
inky	UTSW	17	73921351	missense	probably damaging	1.00
nucleus	UTSW	17	73899012	nonsense	probably null
squidgame	UTSW	17	73939836	missense	probably benign
R0018:Xdh	UTSW	17	73925025	missense	probably benign	0.00
R0018:Xdh	UTSW	17	73925025	missense	probably benign	0.00
R0033:Xdh	UTSW	17	73907632	missense	probably benign	0.06
R0079:Xdh	UTSW	17	73891218	missense	probably damaging	1.00
R0086:Xdh	UTSW	17	73884438	missense	probably benign
R0319:Xdh	UTSW	17	73906101	splice site	probably benign
R0336:Xdh	UTSW	17	73922463	missense	possibly damaging	0.91
R0389:Xdh	UTSW	17	73898362	missense	probably damaging	1.00
R0684:Xdh	UTSW	17	73943891	missense	probably damaging	0.97
R0930:Xdh	UTSW	17	73923082	missense	probably benign	0.00
R1073:Xdh	UTSW	17	73939836	missense	probably benign
R1114:Xdh	UTSW	17	73941149	splice site	probably benign
R1201:Xdh	UTSW	17	73918418	missense	probably benign	0.05
R1230:Xdh	UTSW	17	73891256	missense	probably damaging	1.00
R1351:Xdh	UTSW	17	73923078	missense	probably benign	0.02
R1470:Xdh	UTSW	17	73891112	missense	probably damaging	1.00
R1470:Xdh	UTSW	17	73891112	missense	probably damaging	1.00
R1485:Xdh	UTSW	17	73914019	nonsense	probably null
R1548:Xdh	UTSW	17	73913901	missense	probably damaging	0.98
R1637:Xdh	UTSW	17	73900578	missense	probably benign
R1641:Xdh	UTSW	17	73926552	missense	probably benign
R1758:Xdh	UTSW	17	73910209	missense	probably damaging	1.00
R1951:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R1969:Xdh	UTSW	17	73892751	missense	possibly damaging	0.55
R2024:Xdh	UTSW	17	73921305	missense	possibly damaging	0.92
R2080:Xdh	UTSW	17	73909325	missense	probably damaging	1.00
R2157:Xdh	UTSW	17	73922537	missense	probably damaging	1.00
R2300:Xdh	UTSW	17	73891265	missense	probably damaging	1.00
R3783:Xdh	UTSW	17	73893595	splice site	probably benign
R3796:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3797:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3798:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3799:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3819:Xdh	UTSW	17	73906725	missense	probably benign	0.35
R4085:Xdh	UTSW	17	73916879	missense	probably benign	0.35
R4240:Xdh	UTSW	17	73895795	missense	possibly damaging	0.72
R4356:Xdh	UTSW	17	73915690	missense	probably benign	0.01
R4522:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4523:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4524:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4600:Xdh	UTSW	17	73910200	missense	probably benign	0.19
R4617:Xdh	UTSW	17	73918394	missense	probably damaging	0.99
R4756:Xdh	UTSW	17	73886386	missense	probably benign	0.24
R4761:Xdh	UTSW	17	73910267	missense	possibly damaging	0.91
R4815:Xdh	UTSW	17	73906215	missense	probably damaging	1.00
R4850:Xdh	UTSW	17	73898335	missense	probably damaging	1.00
R4896:Xdh	UTSW	17	73910243	missense	probably damaging	0.96
R4897:Xdh	UTSW	17	73900708	missense	probably benign
R4923:Xdh	UTSW	17	73924936	missense	possibly damaging	0.72
R4977:Xdh	UTSW	17	73898970	missense	probably benign	0.05
R5030:Xdh	UTSW	17	73891293	missense	probably damaging	1.00
R5185:Xdh	UTSW	17	73925011	missense	probably damaging	1.00
R5347:Xdh	UTSW	17	73925032	missense	probably benign
R5556:Xdh	UTSW	17	73897764	missense	probably benign	0.21
R5566:Xdh	UTSW	17	73893622	missense	probably damaging	1.00
R5568:Xdh	UTSW	17	73943885	missense	possibly damaging	0.90
R5635:Xdh	UTSW	17	73913875	missense	possibly damaging	0.92
R5662:Xdh	UTSW	17	73941115	missense	probably damaging	0.99
R5955:Xdh	UTSW	17	73898320	missense	probably damaging	1.00
R6058:Xdh	UTSW	17	73906269	missense	probably damaging	1.00
R6061:Xdh	UTSW	17	73921347	missense	probably damaging	1.00
R6412:Xdh	UTSW	17	73935907	missense	probably benign	0.09
R6526:Xdh	UTSW	17	73900551	missense	probably damaging	0.97
R6558:Xdh	UTSW	17	73893713	missense	possibly damaging	0.95
R6843:Xdh	UTSW	17	73923130	missense	probably damaging	1.00
R6932:Xdh	UTSW	17	73922562	missense	probably damaging	0.99
R7028:Xdh	UTSW	17	73943873	missense	probably damaging	0.99
R7418:Xdh	UTSW	17	73913965	missense	possibly damaging	0.81
R7503:Xdh	UTSW	17	73926210	missense	probably damaging	1.00
R7653:Xdh	UTSW	17	73897045	missense	probably benign	0.10
R7763:Xdh	UTSW	17	73934834	missense	possibly damaging	0.69
R7768:Xdh	UTSW	17	73939836	missense	probably benign
R7904:Xdh	UTSW	17	73922472	missense	probably benign	0.09
R8010:Xdh	UTSW	17	73909317	nonsense	probably null
R8067:Xdh	UTSW	17	73900657	missense	probably benign	0.01
R8238:Xdh	UTSW	17	73886417	missense	probably benign
R8253:Xdh	UTSW	17	73918382	missense	possibly damaging	0.94
R8346:Xdh	UTSW	17	73913943	missense	probably damaging	1.00
R8350:Xdh	UTSW	17	73934842	missense	probably damaging	1.00
R8381:Xdh	UTSW	17	73912461	missense	probably benign
R8427:Xdh	UTSW	17	73935931	missense	probably damaging	1.00
R8465:Xdh	UTSW	17	73899012	nonsense	probably null
R8478:Xdh	UTSW	17	73906058	missense	probably benign	0.00
R8680:Xdh	UTSW	17	73922505	missense	probably benign
R8802:Xdh	UTSW	17	73918410	missense	probably benign	0.00
R8984:Xdh	UTSW	17	73921351	missense	probably damaging	1.00
R8985:Xdh	UTSW	17	73921351	missense	probably damaging	1.00
R8995:Xdh	UTSW	17	73898374	missense	probably damaging	1.00
R9035:Xdh	UTSW	17	73910227	missense	probably benign
R9149:Xdh	UTSW	17	73915693	missense	probably benign
R9181:Xdh	UTSW	17	73925011	missense	probably damaging	1.00
R9357:Xdh	UTSW	17	73907716	missense	probably damaging	0.97
R9357:Xdh	UTSW	17	73926546	critical splice donor site	probably null
R9609:Xdh	UTSW	17	73924995	missense	possibly damaging	0.91
X0019:Xdh	UTSW	17	73918454	missense	probably damaging	1.00
Z1088:Xdh	UTSW	17	73886428	missense	probably benign
Z1176:Xdh	UTSW	17	73923042	critical splice donor site	probably null
Z1177:Xdh	UTSW	17	73897695	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAGAACCTGGGCTTAACGAG -3'
(R):5'- CTGGCTCTGTTTTACAGGCAC -3'

Sequencing Primer
(F):5'- CTGTCTCTCCAACCTTGAGGGAG -3'
(R):5'- CACAGCCTATGTAAAGTCTTTCCAGG -3'

Posted On

2022-11-14