Incidental Mutation 'R9803:Pcdhgb7'
ID 735341
Institutional Source Beutler Lab
Gene Symbol Pcdhgb7
Ensembl Gene ENSMUSG00000104063
Gene Name protocadherin gamma subfamily B, 7
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 37884672-37974923 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37885088 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 86 (V86E)
Ref Sequence ENSEMBL: ENSMUSP00000141997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003599] [ENSMUST00000061279] [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000091935] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192535] [ENSMUST00000192931] [ENSMUST00000194928] [ENSMUST00000193404] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112] [ENSMUST00000195363] [ENSMUST00000195823]
AlphaFold Q91XX3
Predicted Effect probably benign
Transcript: ENSMUST00000003599
SMART Domains Protein: ENSMUSP00000003599
Gene: ENSMUSG00000103088

DomainStartEndE-ValueType
CA 47 131 8.06e-6 SMART
CA 155 240 2.29e-19 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 4.94e-24 SMART
CA 474 560 7.6e-25 SMART
CA 591 672 9.18e-10 SMART
Pfam:Cadherin_C_2 687 768 3.5e-20 PFAM
Pfam:Cadherin_tail 807 930 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061279
SMART Domains Protein: ENSMUSP00000058362
Gene: ENSMUSG00000102742

DomainStartEndE-ValueType
CA 45 131 3.23e-2 SMART
CA 155 240 2.22e-17 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 7.09e-25 SMART
CA 474 560 3.55e-25 SMART
CA 591 669 2.53e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 914 933 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091935
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192535
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194928
AA Change: V86E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141997
Gene: ENSMUSG00000104063
AA Change: V86E

DomainStartEndE-ValueType
CA 47 131 2.48e-6 SMART
CA 155 240 1.57e-17 SMART
CA 264 343 1.29e-27 SMART
CA 367 448 9.14e-28 SMART
CA 472 558 1.24e-24 SMART
CA 589 670 3.73e-10 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 716 721 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193404
SMART Domains Protein: ENSMUSP00000141359
Gene: ENSMUSG00000102222

DomainStartEndE-ValueType
CA 43 129 2.76e-2 SMART
CA 153 238 1.16e-20 SMART
CA 262 343 1.25e-25 SMART
CA 367 448 4.75e-26 SMART
CA 472 558 3.69e-23 SMART
CA 589 667 3.84e-12 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Ccdc87 A G 19: 4,891,175 (GRCm39) T556A probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Pcdhgb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03134:Pcdhgb7 UTSW 18 37,884,935 (GRCm39) missense probably damaging 1.00
R3820:Pcdhgb7 UTSW 18 37,885,286 (GRCm39) missense possibly damaging 0.79
R3821:Pcdhgb7 UTSW 18 37,885,286 (GRCm39) missense possibly damaging 0.79
R4014:Pcdhgb7 UTSW 18 37,885,416 (GRCm39) missense probably benign 0.01
R4223:Pcdhgb7 UTSW 18 37,886,856 (GRCm39) missense probably benign 0.06
R4224:Pcdhgb7 UTSW 18 37,886,856 (GRCm39) missense probably benign 0.06
R4225:Pcdhgb7 UTSW 18 37,886,856 (GRCm39) missense probably benign 0.06
R4366:Pcdhgb7 UTSW 18 37,887,125 (GRCm39) missense possibly damaging 0.62
R4622:Pcdhgb7 UTSW 18 37,886,183 (GRCm39) missense probably benign 0.00
R5117:Pcdhgb7 UTSW 18 37,885,939 (GRCm39) missense probably damaging 0.99
R5226:Pcdhgb7 UTSW 18 37,885,577 (GRCm39) missense probably benign 0.32
R5253:Pcdhgb7 UTSW 18 37,886,150 (GRCm39) missense possibly damaging 0.82
R5317:Pcdhgb7 UTSW 18 37,885,887 (GRCm39) missense probably benign 0.01
R6183:Pcdhgb7 UTSW 18 37,885,315 (GRCm39) missense probably damaging 0.97
R6497:Pcdhgb7 UTSW 18 37,886,906 (GRCm39) missense probably damaging 1.00
R6590:Pcdhgb7 UTSW 18 37,886,050 (GRCm39) missense probably benign 0.00
R6690:Pcdhgb7 UTSW 18 37,886,050 (GRCm39) missense probably benign 0.00
R7022:Pcdhgb7 UTSW 18 37,886,086 (GRCm39) missense probably damaging 0.98
R7703:Pcdhgb7 UTSW 18 37,885,321 (GRCm39) missense probably benign
R8473:Pcdhgb7 UTSW 18 37,886,852 (GRCm39) missense probably benign 0.00
R8859:Pcdhgb7 UTSW 18 37,886,349 (GRCm39) missense possibly damaging 0.69
R8873:Pcdhgb7 UTSW 18 37,886,575 (GRCm39) missense possibly damaging 0.90
R8970:Pcdhgb7 UTSW 18 37,885,631 (GRCm39) missense probably benign 0.00
R8995:Pcdhgb7 UTSW 18 37,885,230 (GRCm39) missense probably damaging 1.00
R9280:Pcdhgb7 UTSW 18 37,886,585 (GRCm39) missense probably damaging 1.00
R9370:Pcdhgb7 UTSW 18 37,884,937 (GRCm39) missense possibly damaging 0.93
R9439:Pcdhgb7 UTSW 18 37,884,917 (GRCm39) missense probably benign 0.06
R9523:Pcdhgb7 UTSW 18 37,886,636 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTACTGTTTATCCTGCTGC -3'
(R):5'- ACTCCAGAATTGTTCTCGCC -3'

Sequencing Primer
(F):5'- TGTTCTGTCCCGCGCTGG -3'
(R):5'- AGAATTGTTCTCGCCCCTGGG -3'
Posted On 2022-11-14