Incidental Mutation 'R9803:Ccdc87'
ID 735342
Institutional Source Beutler Lab
Gene Symbol Ccdc87
Ensembl Gene ENSMUSG00000067872
Gene Name coiled-coil domain containing 87
Synonyms 4931419P11Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 4889394-4892556 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4891175 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 556 (T556A)
Ref Sequence ENSEMBL: ENSMUSP00000086028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037246] [ENSMUST00000088653]
AlphaFold Q8CDL9
Predicted Effect probably benign
Transcript: ENSMUST00000037246
SMART Domains Protein: ENSMUSP00000035486
Gene: ENSMUSG00000034108

DomainStartEndE-ValueType
Pfam:HMA 15 72 2.4e-12 PFAM
Pfam:Sod_Cu 93 230 6.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088653
AA Change: T556A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086028
Gene: ENSMUSG00000067872
AA Change: T556A

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 287 296 N/A INTRINSIC
low complexity region 326 341 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
Pfam:MAP65_ASE1 669 855 2.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,841,964 (GRCm39) S52P unknown Het
Ank2 A G 3: 126,752,726 (GRCm39) M330T possibly damaging Het
Ankar C T 1: 72,698,340 (GRCm39) V905I possibly damaging Het
Anln G T 9: 22,283,518 (GRCm39) D438E probably damaging Het
C1ql3 T C 2: 13,009,200 (GRCm39) N215S probably damaging Het
Ccdc110 A G 8: 46,395,626 (GRCm39) S506G probably benign Het
Cma1 A T 14: 56,179,186 (GRCm39) N236K probably benign Het
Csmd2 T C 4: 128,262,986 (GRCm39) F724S Het
Cts8 T C 13: 61,401,136 (GRCm39) K130R possibly damaging Het
Daam1 A T 12: 71,990,922 (GRCm39) T179S unknown Het
Fancd2os T C 6: 113,574,938 (GRCm39) T23A possibly damaging Het
Gbgt1 T A 2: 28,394,866 (GRCm39) I168N probably damaging Het
Gckr G A 5: 31,457,368 (GRCm39) G127D probably damaging Het
Gm11444 G A 11: 85,737,699 (GRCm39) Q164* probably null Het
Gm28042 T A 2: 119,868,984 (GRCm39) V526E possibly damaging Het
Gm8947 T C 1: 151,068,722 (GRCm39) V185A possibly damaging Het
Hoxd13 C A 2: 74,499,247 (GRCm39) H198Q possibly damaging Het
Hps6 T A 19: 45,993,947 (GRCm39) L628* probably null Het
Igha G A 12: 113,222,759 (GRCm39) H221Y Het
Ighm A G 12: 113,382,635 (GRCm39) S453P Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Lfng A G 5: 140,593,528 (GRCm39) T120A probably damaging Het
Lrrc4 C T 6: 28,662,199 (GRCm39) A172T probably benign Het
Lrrc56 A G 7: 140,787,520 (GRCm39) T386A probably benign Het
Mapkbp1 A T 2: 119,841,256 (GRCm39) H81L probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrto4 T A 4: 139,076,381 (GRCm39) N70I probably damaging Het
Mxra8 C T 4: 155,924,282 (GRCm39) probably benign Het
Myo1h A G 5: 114,483,997 (GRCm39) E548G Het
Ncan C T 8: 70,560,751 (GRCm39) D739N probably benign Het
Or2t45 T C 11: 58,669,595 (GRCm39) V214A probably benign Het
Oxgr1 T C 14: 120,259,563 (GRCm39) T215A possibly damaging Het
Pcdhgb7 T A 18: 37,885,088 (GRCm39) V86E probably damaging Het
Pclo G A 5: 14,762,629 (GRCm39) V416M Het
Phf3 G T 1: 30,869,872 (GRCm39) T392K probably benign Het
Pkhd1 A T 1: 20,637,073 (GRCm39) V379E probably damaging Het
Ppfia3 T C 7: 44,990,539 (GRCm39) Y1080C probably benign Het
Ptprs C A 17: 56,729,217 (GRCm39) G1254C probably damaging Het
Qsox1 A T 1: 155,658,416 (GRCm39) D384E probably benign Het
Rergl A G 6: 139,477,761 (GRCm39) F23L probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Sidt2 A G 9: 45,854,912 (GRCm39) Y588H probably damaging Het
Tas2r139 T A 6: 42,118,066 (GRCm39) I66K probably damaging Het
Tbc1d30 T A 10: 121,107,980 (GRCm39) D474V probably damaging Het
Tenm4 G A 7: 96,202,685 (GRCm39) G100D probably damaging Het
Tmem258 G A 19: 10,184,637 (GRCm39) V75I probably benign Het
Tmem91 G T 7: 25,369,988 (GRCm39) H95N probably damaging Het
Trps1 T C 15: 50,710,090 (GRCm39) K87E possibly damaging Het
Tspan11 T A 6: 127,920,680 (GRCm39) M209K probably benign Het
Tspan17 C A 13: 54,941,092 (GRCm39) Q124K probably benign Het
Uts2b G A 16: 27,179,692 (GRCm39) R105* probably null Het
Vmn2r110 T A 17: 20,803,730 (GRCm39) T282S probably benign Het
Xdh T A 17: 74,229,455 (GRCm39) M333L probably benign Het
Zbtb3 A G 19: 8,781,833 (GRCm39) E482G probably damaging Het
Other mutations in Ccdc87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Ccdc87 APN 19 4,891,059 (GRCm39) missense probably damaging 1.00
IGL02754:Ccdc87 APN 19 4,889,889 (GRCm39) missense probably damaging 1.00
IGL03124:Ccdc87 APN 19 4,891,082 (GRCm39) missense probably damaging 0.99
IGL03151:Ccdc87 APN 19 4,891,585 (GRCm39) missense probably benign 0.01
R1572:Ccdc87 UTSW 19 4,890,341 (GRCm39) missense probably benign 0.03
R2031:Ccdc87 UTSW 19 4,891,715 (GRCm39) missense probably damaging 1.00
R3714:Ccdc87 UTSW 19 4,890,287 (GRCm39) missense probably benign 0.00
R3734:Ccdc87 UTSW 19 4,891,951 (GRCm39) missense probably damaging 1.00
R3854:Ccdc87 UTSW 19 4,889,546 (GRCm39) missense probably benign 0.36
R4643:Ccdc87 UTSW 19 4,891,877 (GRCm39) missense probably damaging 1.00
R4820:Ccdc87 UTSW 19 4,890,579 (GRCm39) missense probably damaging 1.00
R5039:Ccdc87 UTSW 19 4,890,429 (GRCm39) splice site probably null
R5634:Ccdc87 UTSW 19 4,890,693 (GRCm39) missense probably benign 0.00
R5659:Ccdc87 UTSW 19 4,890,878 (GRCm39) missense probably damaging 0.99
R6065:Ccdc87 UTSW 19 4,891,268 (GRCm39) missense probably benign
R6237:Ccdc87 UTSW 19 4,891,407 (GRCm39) missense probably benign 0.15
R6337:Ccdc87 UTSW 19 4,889,829 (GRCm39) missense probably benign 0.00
R6349:Ccdc87 UTSW 19 4,891,347 (GRCm39) missense probably damaging 1.00
R6429:Ccdc87 UTSW 19 4,891,263 (GRCm39) missense probably benign 0.06
R6520:Ccdc87 UTSW 19 4,891,817 (GRCm39) missense probably damaging 0.99
R7131:Ccdc87 UTSW 19 4,891,785 (GRCm39) missense probably damaging 1.00
R7237:Ccdc87 UTSW 19 4,889,790 (GRCm39) missense probably benign 0.00
R7349:Ccdc87 UTSW 19 4,891,868 (GRCm39) missense probably damaging 0.98
R7848:Ccdc87 UTSW 19 4,891,536 (GRCm39) missense probably damaging 1.00
R8382:Ccdc87 UTSW 19 4,890,018 (GRCm39) missense possibly damaging 0.88
R8421:Ccdc87 UTSW 19 4,891,313 (GRCm39) missense possibly damaging 0.79
R8560:Ccdc87 UTSW 19 4,891,901 (GRCm39) missense probably damaging 1.00
R8747:Ccdc87 UTSW 19 4,891,646 (GRCm39) missense probably benign 0.01
R9457:Ccdc87 UTSW 19 4,891,659 (GRCm39) missense probably damaging 1.00
R9679:Ccdc87 UTSW 19 4,891,299 (GRCm39) missense probably benign 0.05
Z1088:Ccdc87 UTSW 19 4,890,750 (GRCm39) missense probably benign 0.02
Z1176:Ccdc87 UTSW 19 4,891,951 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAGCCGAGTCTCTGTTAGTC -3'
(R):5'- AGGTACTCTTGGACAGGGAC -3'

Sequencing Primer
(F):5'- CACTTATCTTTTGAGGAAGGAGACC -3'
(R):5'- TCATACATTTGGAAGATGACGTGG -3'
Posted On 2022-11-14