Mutagenetix > Incidental Mutation

Incidental Mutation 'R9652:Gusb'

735368

Institutional Source

Beutler Lab

Gene Symbol

Gusb

Ensembl Gene

ENSMUSG00000025534

Gene Name

glucuronidase, beta

Synonyms

Gut, Gus, asd, Gur, g, Gus-s, Gus-r, adipose storage deficiency, Gus-u, Gus-t

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R9652 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

129989011-130003049 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 129997811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 450 (S450P)

Ref Sequence

ENSEMBL: ENSMUSP00000026613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026613] [ENSMUST00000111307] [ENSMUST00000111308] [ENSMUST00000201801]

AlphaFold

P12265

Predicted Effect

probably damaging
Transcript: ENSMUST00000026613
AA Change: S450P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026613
Gene: ENSMUSG00000025534
AA Change: S450P

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_2_N	35	223	4e-46	PFAM
Pfam:Glyco_hydro_2	225	323	6.4e-12	PFAM
Pfam:Glyco_hydro_2_C	325	627	9e-117	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111307

SMART Domains

Protein: ENSMUSP00000106939
Gene: ENSMUSG00000025534

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_2_N	35	143	2.1e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111308

SMART Domains

Protein: ENSMUSP00000106940
Gene: ENSMUSG00000025534

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_2_N	35	223	7.7e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201801

SMART Domains

Protein: ENSMUSP00000144478
Gene: ENSMUSG00000025534

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_2_N	35	138	5.5e-19	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.6%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that degrades glycosaminoglycans, including heparan sulfate, dermatan sulfate, and chondroitin-4,6-sulfate. The enzyme forms a homotetramer that is localized to the lysosome. Mutations in this gene result in mucopolysaccharidosis type VII. Alternative splicing results in multiple transcript variants. There are many pseudogenes of this locus in the human genome.[provided by RefSeq, May 2014]
PHENOTYPE: Knock-in mutations of this gene lead to lysosomal storage disease and may cause premature death, facial, tail and limb anomalies, growth retardation, male sterility, reduced lactation, osteosclerosis and behavioral defects. Additional phenotypes include partial neonatal death and deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afap1l1	G	A	18: 61,743,361	T395M	probably damaging	Het
Akap8l	T	C	17: 32,338,809	N35D	probably damaging	Het
Atr	T	A	9: 95,874,834	L922Q	probably damaging	Het
B3gnt9	G	T	8: 105,254,497	F86L	probably damaging	Het
Bmp1	T	C	14: 70,477,920	D925G	probably damaging	Het
C77080	T	C	4: 129,224,169	E279G	possibly damaging	Het
Camkmt	A	T	17: 85,452,285	R284S	probably benign	Het
Cavin3	G	T	7: 105,482,097	H21Q	probably damaging	Het
Ccp110	A	G	7: 118,735,330	H180R		Het
Cdh23	A	T	10: 60,331,356	V1837E	probably damaging	Het
Ces3b	G	T	8: 105,085,625	A169S	probably damaging	Het
Chpt1	T	C	10: 88,489,637	N122S	probably benign	Het
Cramp1l	C	A	17: 24,982,809	K566N	probably damaging	Het
Ctbp2	C	G	7: 133,014,204	R334P	probably damaging	Het
Cwh43	T	C	5: 73,414,997	S193P	probably benign	Het
Dcstamp	A	T	15: 39,760,396	D469V	probably benign	Het
Dst	T	A	1: 34,180,377	I1966N	probably benign	Het
Eif3i	G	T	4: 129,595,301	F121L	probably benign	Het
Erbb2	T	C	11: 98,435,986	S1074P	probably damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fbn2	A	G	18: 58,013,650		probably null	Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Gm2a	T	C	11: 55,108,938	V95A	probably benign	Het
Gp5	A	C	16: 30,309,575	F94V	probably damaging	Het
Gramd4	G	A	15: 86,131,959	E504K	probably damaging	Het
Htr5a	A	G	5: 27,842,840	N131S	possibly damaging	Het
Itga2	G	A	13: 114,884,455	P120L	probably benign	Het
Itpkb	G	T	1: 180,332,491	E61*	probably null	Het
Katnbl1	T	A	2: 112,409,152	V232D	probably damaging	Het
Kifap3	T	C	1: 163,862,088	L547P	probably damaging	Het
Krt6a	C	T	15: 101,690,685	V482M	probably benign	Het
Lrfn5	T	A	12: 61,843,632	V569D	probably damaging	Het
Luzp2	A	G	7: 55,052,832	T48A	probably damaging	Het
Mical2	G	T	7: 112,346,789	R986L	probably damaging	Het
Mroh8	G	A	2: 157,253,050	Q339*	probably null	Het
Msln	A	T	17: 25,749,068	V541E	probably damaging	Het
Muc16	T	A	9: 18,586,882	M6590L	probably benign	Het
Nisch	A	T	14: 31,171,671	V1315E	probably damaging	Het
Nubp2	G	A	17: 24,884,408	T165I	probably damaging	Het
Olfr1089	A	T	2: 86,733,292	F107I	probably damaging	Het
Olfr13	A	G	6: 43,174,057	M24V	probably benign	Het
Olfr57	T	C	10: 79,035,396	I200T	probably benign	Het
Olfr682-ps1	A	T	7: 105,126,778	N164K	probably benign	Het
Olfr820	T	C	10: 130,017,940	I193T	possibly damaging	Het
Oog3	T	G	4: 144,157,919	R482S	probably benign	Het
P3h4	A	T	11: 100,413,673	C247*	probably null	Het
Palm2	G	A	4: 57,710,125	A357T	possibly damaging	Het
Plch2	T	A	4: 154,998,485	M569L	probably benign	Het
Plcl1	A	G	1: 55,696,291	T264A	probably benign	Het
Rad51ap1	G	T	6: 126,927,563	N178K	probably benign	Het
Rasa4	T	C	5: 136,101,640	L340P	probably damaging	Het
Rassf10	A	G	7: 112,955,577	T462A	probably benign	Het
Rlf	G	C	4: 121,150,668	L482V	probably damaging	Het
Robo1	T	G	16: 73,024,442	S1357A	possibly damaging	Het
Rp1l1	T	C	14: 64,032,265	S1767P	probably damaging	Het
Rpl3l	T	A	17: 24,728,354	L14Q	probably damaging	Het
Ryr3	T	A	2: 112,804,702	T2024S	possibly damaging	Het
Sbf2	T	C	7: 110,441,495	Q375R	possibly damaging	Het
Sema6a	T	C	18: 47,249,185	Q765R	probably damaging	Het
Senp6	T	A	9: 80,113,946	Y303N	probably damaging	Het
Sertad4	C	T	1: 192,846,528	D327N	probably damaging	Het
Slc22a15	T	A	3: 101,883,532	Y219F	possibly damaging	Het
Slco1b2	T	G	6: 141,648,632		probably null	Het
Snrnp200	G	T	2: 127,226,039	V819L	probably damaging	Het
Ssb	C	A	2: 69,870,440	A288E	probably damaging	Het
Syne2	A	G	12: 76,054,846	H638R	probably benign	Het
Tm7sf3	A	G	6: 146,626,200	S43P	probably benign	Het
Tmem200c	A	G	17: 68,842,186	H588R	probably benign	Het
Tnpo3	G	A	6: 29,560,174	R657*	probably null	Het
Traf6	T	C	2: 101,688,582	C139R	probably damaging	Het
Txnrd1	C	A	10: 82,884,556	N424K	possibly damaging	Het
Ubqln3	T	C	7: 104,142,755	I43V	probably damaging	Het
Usp32	A	G	11: 85,030,491	V699A	probably damaging	Het
Vmn2r103	T	C	17: 19,793,765	V273A	probably benign	Het
Vmn2r8	A	G	5: 108,803,241	S113P	probably benign	Het
Wdr7	T	A	18: 63,727,755	I161N	probably damaging	Het
Zfp474	A	T	18: 52,638,943	I223F	probably damaging	Het
Zfp583	A	G	7: 6,317,329	L228P	probably damaging	Het
Zfyve27	A	G	19: 42,177,417	T76A	possibly damaging	Het

Other mutations in Gusb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:Gusb	APN	5	129999381	missense	probably damaging	1.00
IGL01561:Gusb	APN	5	129998086	missense	probably damaging	1.00
IGL02642:Gusb	APN	5	130000535	splice site	probably null
IGL03307:Gusb	APN	5	130000031	makesense	probably null
R0389:Gusb	UTSW	5	129998086	missense	probably damaging	1.00
R1496:Gusb	UTSW	5	129998544	missense	probably benign	0.00
R1512:Gusb	UTSW	5	130000890	missense	probably damaging	1.00
R2125:Gusb	UTSW	5	129999447	missense	probably benign	0.00
R2888:Gusb	UTSW	5	130000502	missense	probably damaging	1.00
R2890:Gusb	UTSW	5	130000502	missense	probably damaging	1.00
R3017:Gusb	UTSW	5	130000484	missense	probably damaging	1.00
R4453:Gusb	UTSW	5	129998483	missense	possibly damaging	0.84
R4906:Gusb	UTSW	5	129998118	missense	probably damaging	0.98
R4937:Gusb	UTSW	5	129995485	missense	probably damaging	0.99
R5260:Gusb	UTSW	5	129999988	nonsense	probably null
R5281:Gusb	UTSW	5	129998526	missense	probably benign	0.00
R6194:Gusb	UTSW	5	129990065	missense	possibly damaging	0.46
R6248:Gusb	UTSW	5	130000525	missense	probably benign	0.01
R7121:Gusb	UTSW	5	130000043	missense	probably benign	0.44
R7209:Gusb	UTSW	5	129998546	missense	probably benign
R7768:Gusb	UTSW	5	130000405	missense	probably benign	0.01
R8223:Gusb	UTSW	5	129990112	missense	probably benign	0.00
Z1177:Gusb	UTSW	5	130002736	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- TCTCCAGTAGTGATGAAGGGGATAC -3'
(R):5'- CATTGTGCTACCGTGAGTGC -3'

Sequencing Primer
(F):5'- GGGGATACTGACATCACAGCAC -3'
(R):5'- TCGCCGTCTACGATGCC -3'

Posted On

2022-11-14