Mutagenetix > Incidental Mutation

Incidental Mutation 'R9652:Ubqln3'

735377

Institutional Source

Beutler Lab

Gene Symbol

Ubqln3

Ensembl Gene

ENSMUSG00000051618

Gene Name

ubiquilin 3

Synonyms

4933400K24Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R9652 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104140623-104143279 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104142755 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 43 (I43V)

Ref Sequence

ENSEMBL: ENSMUSP00000055229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057254]

AlphaFold

Q8C5U9

Predicted Effect

probably damaging
Transcript: ENSMUST00000057254
AA Change: I43V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: I43V

Domain	Start	End	E-Value	Type
UBQ	22	92	1.56e-15	SMART
low complexity region	103	115	N/A	INTRINSIC
low complexity region	120	151	N/A	INTRINSIC
STI1	194	233	4.25e-7	SMART
low complexity region	280	291	N/A	INTRINSIC
low complexity region	313	328	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
UBA	619	657	4.22e-4	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.6%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afap1l1	G	A	18: 61,743,361	T395M	probably damaging	Het
Akap8l	T	C	17: 32,338,809	N35D	probably damaging	Het
Atr	T	A	9: 95,874,834	L922Q	probably damaging	Het
B3gnt9	G	T	8: 105,254,497	F86L	probably damaging	Het
Bmp1	T	C	14: 70,477,920	D925G	probably damaging	Het
C77080	T	C	4: 129,224,169	E279G	possibly damaging	Het
Camkmt	A	T	17: 85,452,285	R284S	probably benign	Het
Cavin3	G	T	7: 105,482,097	H21Q	probably damaging	Het
Ccp110	A	G	7: 118,735,330	H180R		Het
Cdh23	A	T	10: 60,331,356	V1837E	probably damaging	Het
Ces3b	G	T	8: 105,085,625	A169S	probably damaging	Het
Chpt1	T	C	10: 88,489,637	N122S	probably benign	Het
Cramp1l	C	A	17: 24,982,809	K566N	probably damaging	Het
Ctbp2	C	G	7: 133,014,204	R334P	probably damaging	Het
Cwh43	T	C	5: 73,414,997	S193P	probably benign	Het
Dcstamp	A	T	15: 39,760,396	D469V	probably benign	Het
Dst	T	A	1: 34,180,377	I1966N	probably benign	Het
Eif3i	G	T	4: 129,595,301	F121L	probably benign	Het
Erbb2	T	C	11: 98,435,986	S1074P	probably damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fbn2	A	G	18: 58,013,650		probably null	Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Gm2a	T	C	11: 55,108,938	V95A	probably benign	Het
Gp5	A	C	16: 30,309,575	F94V	probably damaging	Het
Gramd4	G	A	15: 86,131,959	E504K	probably damaging	Het
Gusb	A	G	5: 129,997,811	S450P	probably damaging	Het
Htr5a	A	G	5: 27,842,840	N131S	possibly damaging	Het
Itga2	G	A	13: 114,884,455	P120L	probably benign	Het
Itpkb	G	T	1: 180,332,491	E61*	probably null	Het
Katnbl1	T	A	2: 112,409,152	V232D	probably damaging	Het
Kifap3	T	C	1: 163,862,088	L547P	probably damaging	Het
Krt6a	C	T	15: 101,690,685	V482M	probably benign	Het
Lrfn5	T	A	12: 61,843,632	V569D	probably damaging	Het
Luzp2	A	G	7: 55,052,832	T48A	probably damaging	Het
Mical2	G	T	7: 112,346,789	R986L	probably damaging	Het
Mroh8	G	A	2: 157,253,050	Q339*	probably null	Het
Msln	A	T	17: 25,749,068	V541E	probably damaging	Het
Muc16	T	A	9: 18,586,882	M6590L	probably benign	Het
Nisch	A	T	14: 31,171,671	V1315E	probably damaging	Het
Nubp2	G	A	17: 24,884,408	T165I	probably damaging	Het
Olfr1089	A	T	2: 86,733,292	F107I	probably damaging	Het
Olfr13	A	G	6: 43,174,057	M24V	probably benign	Het
Olfr57	T	C	10: 79,035,396	I200T	probably benign	Het
Olfr682-ps1	A	T	7: 105,126,778	N164K	probably benign	Het
Olfr820	T	C	10: 130,017,940	I193T	possibly damaging	Het
Oog3	T	G	4: 144,157,919	R482S	probably benign	Het
P3h4	A	T	11: 100,413,673	C247*	probably null	Het
Palm2	G	A	4: 57,710,125	A357T	possibly damaging	Het
Plch2	T	A	4: 154,998,485	M569L	probably benign	Het
Plcl1	A	G	1: 55,696,291	T264A	probably benign	Het
Rad51ap1	G	T	6: 126,927,563	N178K	probably benign	Het
Rasa4	T	C	5: 136,101,640	L340P	probably damaging	Het
Rassf10	A	G	7: 112,955,577	T462A	probably benign	Het
Rlf	G	C	4: 121,150,668	L482V	probably damaging	Het
Robo1	T	G	16: 73,024,442	S1357A	possibly damaging	Het
Rp1l1	T	C	14: 64,032,265	S1767P	probably damaging	Het
Rpl3l	T	A	17: 24,728,354	L14Q	probably damaging	Het
Ryr3	T	A	2: 112,804,702	T2024S	possibly damaging	Het
Sbf2	T	C	7: 110,441,495	Q375R	possibly damaging	Het
Sema6a	T	C	18: 47,249,185	Q765R	probably damaging	Het
Senp6	T	A	9: 80,113,946	Y303N	probably damaging	Het
Sertad4	C	T	1: 192,846,528	D327N	probably damaging	Het
Slc22a15	T	A	3: 101,883,532	Y219F	possibly damaging	Het
Slco1b2	T	G	6: 141,648,632		probably null	Het
Snrnp200	G	T	2: 127,226,039	V819L	probably damaging	Het
Ssb	C	A	2: 69,870,440	A288E	probably damaging	Het
Syne2	A	G	12: 76,054,846	H638R	probably benign	Het
Tm7sf3	A	G	6: 146,626,200	S43P	probably benign	Het
Tmem200c	A	G	17: 68,842,186	H588R	probably benign	Het
Tnpo3	G	A	6: 29,560,174	R657*	probably null	Het
Traf6	T	C	2: 101,688,582	C139R	probably damaging	Het
Txnrd1	C	A	10: 82,884,556	N424K	possibly damaging	Het
Usp32	A	G	11: 85,030,491	V699A	probably damaging	Het
Vmn2r103	T	C	17: 19,793,765	V273A	probably benign	Het
Vmn2r8	A	G	5: 108,803,241	S113P	probably benign	Het
Wdr7	T	A	18: 63,727,755	I161N	probably damaging	Het
Zfp474	A	T	18: 52,638,943	I223F	probably damaging	Het
Zfp583	A	G	7: 6,317,329	L228P	probably damaging	Het
Zfyve27	A	G	19: 42,177,417	T76A	possibly damaging	Het

Other mutations in Ubqln3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Ubqln3	APN	7	104141777	missense	probably benign	0.00
IGL00766:Ubqln3	APN	7	104142824	missense	probably benign	0.00
IGL01451:Ubqln3	APN	7	104142196	missense	possibly damaging	0.71
IGL01673:Ubqln3	APN	7	104142398	missense	probably benign	0.12
IGL01705:Ubqln3	APN	7	104142677	missense	probably damaging	1.00
IGL01988:Ubqln3	APN	7	104142882	utr 5 prime	probably benign
IGL02008:Ubqln3	APN	7	104142316	missense	probably damaging	1.00
IGL02072:Ubqln3	APN	7	104141299	missense	possibly damaging	0.69
IGL02546:Ubqln3	APN	7	104142518	missense	probably benign	0.02
IGL02657:Ubqln3	APN	7	104141963	missense	probably damaging	0.97
IGL02682:Ubqln3	APN	7	104142065	missense	probably benign	0.19
IGL02709:Ubqln3	APN	7	104141336	missense	probably benign	0.12
IGL03357:Ubqln3	APN	7	104142556	missense	probably benign
PIT4544001:Ubqln3	UTSW	7	104141343	missense	probably damaging	0.97
R0180:Ubqln3	UTSW	7	104141840	missense	probably damaging	1.00
R0845:Ubqln3	UTSW	7	104142068	missense	probably damaging	0.98
R1019:Ubqln3	UTSW	7	104141386	missense	probably benign	0.00
R1280:Ubqln3	UTSW	7	104142076	missense	possibly damaging	0.85
R1448:Ubqln3	UTSW	7	104142790	missense	probably damaging	1.00
R1550:Ubqln3	UTSW	7	104141546	missense	probably damaging	0.98
R1617:Ubqln3	UTSW	7	104142860	missense	possibly damaging	0.95
R1650:Ubqln3	UTSW	7	104141021	missense	possibly damaging	0.84
R2060:Ubqln3	UTSW	7	104142151	missense	probably damaging	1.00
R2246:Ubqln3	UTSW	7	104142311	missense	probably damaging	1.00
R2263:Ubqln3	UTSW	7	104141635	nonsense	probably null
R2366:Ubqln3	UTSW	7	104141049	missense	probably damaging	0.99
R4232:Ubqln3	UTSW	7	104141803	missense	probably benign	0.00
R4447:Ubqln3	UTSW	7	104142814	missense	probably benign	0.31
R4509:Ubqln3	UTSW	7	104141444	missense	probably damaging	0.97
R4604:Ubqln3	UTSW	7	104142491	missense	probably benign	0.00
R5416:Ubqln3	UTSW	7	104141672	missense	probably benign	0.34
R5617:Ubqln3	UTSW	7	104142433	missense	probably damaging	0.99
R5648:Ubqln3	UTSW	7	104140910	missense	probably damaging	0.99
R5722:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5723:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5724:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5819:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5820:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5966:Ubqln3	UTSW	7	104141699	missense	probably benign	0.03
R6260:Ubqln3	UTSW	7	104142317	nonsense	probably null
R6272:Ubqln3	UTSW	7	104142178	missense	probably damaging	1.00
R6542:Ubqln3	UTSW	7	104141617	missense	probably benign	0.00
R6936:Ubqln3	UTSW	7	104142310	missense	probably damaging	1.00
R7023:Ubqln3	UTSW	7	104141423	missense	probably damaging	1.00
R7025:Ubqln3	UTSW	7	104141275	missense	probably benign	0.01
R7079:Ubqln3	UTSW	7	104141371	missense	probably benign	0.12
R7733:Ubqln3	UTSW	7	104141076	missense	probably damaging	0.98
R7764:Ubqln3	UTSW	7	104141236	missense	possibly damaging	0.52
R7919:Ubqln3	UTSW	7	104141192	missense	probably benign	0.03
R7961:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R8009:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R9619:Ubqln3	UTSW	7	104141846	missense	probably benign	0.05
RF054:Ubqln3	UTSW	7	104141178	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCCTGGAATAGAGACTGGTG -3'
(R):5'- GGATGATCTTCGTCTCCCAC -3'

Sequencing Primer
(F):5'- CCTGGAATAGAGACTGGTGGTGATG -3'
(R):5'- CCCCCATCCCCTCAGCTG -3'

Posted On

2022-11-14