Incidental Mutation 'R9652:Ubqln3'
ID 735377
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R9652 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 104140623-104143279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104142755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 43 (I43V)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254]
AlphaFold Q8C5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: I43V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: I43V

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 G A 18: 61,743,361 T395M probably damaging Het
Akap8l T C 17: 32,338,809 N35D probably damaging Het
Atr T A 9: 95,874,834 L922Q probably damaging Het
B3gnt9 G T 8: 105,254,497 F86L probably damaging Het
Bmp1 T C 14: 70,477,920 D925G probably damaging Het
C77080 T C 4: 129,224,169 E279G possibly damaging Het
Camkmt A T 17: 85,452,285 R284S probably benign Het
Cavin3 G T 7: 105,482,097 H21Q probably damaging Het
Ccp110 A G 7: 118,735,330 H180R Het
Cdh23 A T 10: 60,331,356 V1837E probably damaging Het
Ces3b G T 8: 105,085,625 A169S probably damaging Het
Chpt1 T C 10: 88,489,637 N122S probably benign Het
Cramp1l C A 17: 24,982,809 K566N probably damaging Het
Ctbp2 C G 7: 133,014,204 R334P probably damaging Het
Cwh43 T C 5: 73,414,997 S193P probably benign Het
Dcstamp A T 15: 39,760,396 D469V probably benign Het
Dst T A 1: 34,180,377 I1966N probably benign Het
Eif3i G T 4: 129,595,301 F121L probably benign Het
Erbb2 T C 11: 98,435,986 S1074P probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbn2 A G 18: 58,013,650 probably null Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Gm2a T C 11: 55,108,938 V95A probably benign Het
Gp5 A C 16: 30,309,575 F94V probably damaging Het
Gramd4 G A 15: 86,131,959 E504K probably damaging Het
Gusb A G 5: 129,997,811 S450P probably damaging Het
Htr5a A G 5: 27,842,840 N131S possibly damaging Het
Itga2 G A 13: 114,884,455 P120L probably benign Het
Itpkb G T 1: 180,332,491 E61* probably null Het
Katnbl1 T A 2: 112,409,152 V232D probably damaging Het
Kifap3 T C 1: 163,862,088 L547P probably damaging Het
Krt6a C T 15: 101,690,685 V482M probably benign Het
Lrfn5 T A 12: 61,843,632 V569D probably damaging Het
Luzp2 A G 7: 55,052,832 T48A probably damaging Het
Mical2 G T 7: 112,346,789 R986L probably damaging Het
Mroh8 G A 2: 157,253,050 Q339* probably null Het
Msln A T 17: 25,749,068 V541E probably damaging Het
Muc16 T A 9: 18,586,882 M6590L probably benign Het
Nisch A T 14: 31,171,671 V1315E probably damaging Het
Nubp2 G A 17: 24,884,408 T165I probably damaging Het
Olfr1089 A T 2: 86,733,292 F107I probably damaging Het
Olfr13 A G 6: 43,174,057 M24V probably benign Het
Olfr57 T C 10: 79,035,396 I200T probably benign Het
Olfr682-ps1 A T 7: 105,126,778 N164K probably benign Het
Olfr820 T C 10: 130,017,940 I193T possibly damaging Het
Oog3 T G 4: 144,157,919 R482S probably benign Het
P3h4 A T 11: 100,413,673 C247* probably null Het
Palm2 G A 4: 57,710,125 A357T possibly damaging Het
Plch2 T A 4: 154,998,485 M569L probably benign Het
Plcl1 A G 1: 55,696,291 T264A probably benign Het
Rad51ap1 G T 6: 126,927,563 N178K probably benign Het
Rasa4 T C 5: 136,101,640 L340P probably damaging Het
Rassf10 A G 7: 112,955,577 T462A probably benign Het
Rlf G C 4: 121,150,668 L482V probably damaging Het
Robo1 T G 16: 73,024,442 S1357A possibly damaging Het
Rp1l1 T C 14: 64,032,265 S1767P probably damaging Het
Rpl3l T A 17: 24,728,354 L14Q probably damaging Het
Ryr3 T A 2: 112,804,702 T2024S possibly damaging Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sema6a T C 18: 47,249,185 Q765R probably damaging Het
Senp6 T A 9: 80,113,946 Y303N probably damaging Het
Sertad4 C T 1: 192,846,528 D327N probably damaging Het
Slc22a15 T A 3: 101,883,532 Y219F possibly damaging Het
Slco1b2 T G 6: 141,648,632 probably null Het
Snrnp200 G T 2: 127,226,039 V819L probably damaging Het
Ssb C A 2: 69,870,440 A288E probably damaging Het
Syne2 A G 12: 76,054,846 H638R probably benign Het
Tm7sf3 A G 6: 146,626,200 S43P probably benign Het
Tmem200c A G 17: 68,842,186 H588R probably benign Het
Tnpo3 G A 6: 29,560,174 R657* probably null Het
Traf6 T C 2: 101,688,582 C139R probably damaging Het
Txnrd1 C A 10: 82,884,556 N424K possibly damaging Het
Usp32 A G 11: 85,030,491 V699A probably damaging Het
Vmn2r103 T C 17: 19,793,765 V273A probably benign Het
Vmn2r8 A G 5: 108,803,241 S113P probably benign Het
Wdr7 T A 18: 63,727,755 I161N probably damaging Het
Zfp474 A T 18: 52,638,943 I223F probably damaging Het
Zfp583 A G 7: 6,317,329 L228P probably damaging Het
Zfyve27 A G 19: 42,177,417 T76A possibly damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104141777 missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104142824 missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104142196 missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104142398 missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104142677 missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104142882 utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104142316 missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104141299 missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104142518 missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104141963 missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104142065 missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104141336 missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104142556 missense probably benign
PIT4544001:Ubqln3 UTSW 7 104141343 missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 104141840 missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 104142068 missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 104141386 missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104142076 missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 104142790 missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 104141546 missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104142860 missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104141021 missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104142151 missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 104142311 missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104141635 nonsense probably null
R2366:Ubqln3 UTSW 7 104141049 missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104141803 missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104142814 missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104141444 missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104142491 missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104141672 missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104142433 missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104140910 missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104141699 missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104142317 nonsense probably null
R6272:Ubqln3 UTSW 7 104142178 missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 104141617 missense probably benign 0.00
R6936:Ubqln3 UTSW 7 104142310 missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 104141423 missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 104141275 missense probably benign 0.01
R7079:Ubqln3 UTSW 7 104141371 missense probably benign 0.12
R7733:Ubqln3 UTSW 7 104141076 missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104141236 missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 104141192 missense probably benign 0.03
R7961:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
R8009:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
R9619:Ubqln3 UTSW 7 104141846 missense probably benign 0.05
RF054:Ubqln3 UTSW 7 104141178 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCCTGGAATAGAGACTGGTG -3'
(R):5'- GGATGATCTTCGTCTCCCAC -3'

Sequencing Primer
(F):5'- CCTGGAATAGAGACTGGTGGTGATG -3'
(R):5'- CCCCCATCCCCTCAGCTG -3'
Posted On 2022-11-14