Mutagenetix > Incidental Mutation

Incidental Mutation 'R9652:Txnrd1'

735393

Institutional Source

Beutler Lab

Gene Symbol

Txnrd1

Ensembl Gene

ENSMUSG00000020250

Gene Name

thioredoxin reductase 1

Synonyms

TR1, TR, TrxR1, TR alpha

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9652 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

82833951-82897712 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 82884556 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 424 (N424K)

Ref Sequence

ENSEMBL: ENSMUSP00000151629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020484] [ENSMUST00000218694] [ENSMUST00000219368] [ENSMUST00000219442] [ENSMUST00000219962]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020484
AA Change: N310K

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020484
Gene: ENSMUSG00000020250
AA Change: N310K

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	13	350	9.7e-69	PFAM
Pfam:FAD_binding_2	14	69	2.6e-8	PFAM
Pfam:Pyr_redox	192	273	1.3e-18	PFAM
Pfam:Pyr_redox_dim	370	483	8.4e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218694

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219368
AA Change: N424K

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219442
AA Change: N310K

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219962
AA Change: N310K

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.6%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the family of pyridine nucleotide-disulfide oxidoreductases. This protein is a flavoenzyme, which uses NADPH for reduction of thioredoxins as well as other protein and nonprotein substrates, and plays a role in protection against oxidative stress. It contains a selenocysteine (Sec) residue, which is essential for catalytic activity. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit early embryonic lethality (by E10.5) and display severe growth retardation and fail to turn. Embryos also exhibit decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afap1l1	G	A	18: 61,743,361	T395M	probably damaging	Het
Akap8l	T	C	17: 32,338,809	N35D	probably damaging	Het
Atr	T	A	9: 95,874,834	L922Q	probably damaging	Het
B3gnt9	G	T	8: 105,254,497	F86L	probably damaging	Het
Bmp1	T	C	14: 70,477,920	D925G	probably damaging	Het
C77080	T	C	4: 129,224,169	E279G	possibly damaging	Het
Camkmt	A	T	17: 85,452,285	R284S	probably benign	Het
Cavin3	G	T	7: 105,482,097	H21Q	probably damaging	Het
Ccp110	A	G	7: 118,735,330	H180R		Het
Cdh23	A	T	10: 60,331,356	V1837E	probably damaging	Het
Ces3b	G	T	8: 105,085,625	A169S	probably damaging	Het
Chpt1	T	C	10: 88,489,637	N122S	probably benign	Het
Cramp1l	C	A	17: 24,982,809	K566N	probably damaging	Het
Ctbp2	C	G	7: 133,014,204	R334P	probably damaging	Het
Cwh43	T	C	5: 73,414,997	S193P	probably benign	Het
Dcstamp	A	T	15: 39,760,396	D469V	probably benign	Het
Dst	T	A	1: 34,180,377	I1966N	probably benign	Het
Eif3i	G	T	4: 129,595,301	F121L	probably benign	Het
Erbb2	T	C	11: 98,435,986	S1074P	probably damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fbn2	A	G	18: 58,013,650		probably null	Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Gm2a	T	C	11: 55,108,938	V95A	probably benign	Het
Gp5	A	C	16: 30,309,575	F94V	probably damaging	Het
Gramd4	G	A	15: 86,131,959	E504K	probably damaging	Het
Gusb	A	G	5: 129,997,811	S450P	probably damaging	Het
Htr5a	A	G	5: 27,842,840	N131S	possibly damaging	Het
Itga2	G	A	13: 114,884,455	P120L	probably benign	Het
Itpkb	G	T	1: 180,332,491	E61*	probably null	Het
Katnbl1	T	A	2: 112,409,152	V232D	probably damaging	Het
Kifap3	T	C	1: 163,862,088	L547P	probably damaging	Het
Krt6a	C	T	15: 101,690,685	V482M	probably benign	Het
Lrfn5	T	A	12: 61,843,632	V569D	probably damaging	Het
Luzp2	A	G	7: 55,052,832	T48A	probably damaging	Het
Mical2	G	T	7: 112,346,789	R986L	probably damaging	Het
Mroh8	G	A	2: 157,253,050	Q339*	probably null	Het
Msln	A	T	17: 25,749,068	V541E	probably damaging	Het
Muc16	T	A	9: 18,586,882	M6590L	probably benign	Het
Nisch	A	T	14: 31,171,671	V1315E	probably damaging	Het
Nubp2	G	A	17: 24,884,408	T165I	probably damaging	Het
Olfr1089	A	T	2: 86,733,292	F107I	probably damaging	Het
Olfr13	A	G	6: 43,174,057	M24V	probably benign	Het
Olfr57	T	C	10: 79,035,396	I200T	probably benign	Het
Olfr682-ps1	A	T	7: 105,126,778	N164K	probably benign	Het
Olfr820	T	C	10: 130,017,940	I193T	possibly damaging	Het
Oog3	T	G	4: 144,157,919	R482S	probably benign	Het
P3h4	A	T	11: 100,413,673	C247*	probably null	Het
Palm2	G	A	4: 57,710,125	A357T	possibly damaging	Het
Plch2	T	A	4: 154,998,485	M569L	probably benign	Het
Plcl1	A	G	1: 55,696,291	T264A	probably benign	Het
Rad51ap1	G	T	6: 126,927,563	N178K	probably benign	Het
Rasa4	T	C	5: 136,101,640	L340P	probably damaging	Het
Rassf10	A	G	7: 112,955,577	T462A	probably benign	Het
Rlf	G	C	4: 121,150,668	L482V	probably damaging	Het
Robo1	T	G	16: 73,024,442	S1357A	possibly damaging	Het
Rp1l1	T	C	14: 64,032,265	S1767P	probably damaging	Het
Rpl3l	T	A	17: 24,728,354	L14Q	probably damaging	Het
Ryr3	T	A	2: 112,804,702	T2024S	possibly damaging	Het
Sbf2	T	C	7: 110,441,495	Q375R	possibly damaging	Het
Sema6a	T	C	18: 47,249,185	Q765R	probably damaging	Het
Senp6	T	A	9: 80,113,946	Y303N	probably damaging	Het
Sertad4	C	T	1: 192,846,528	D327N	probably damaging	Het
Slc22a15	T	A	3: 101,883,532	Y219F	possibly damaging	Het
Slco1b2	T	G	6: 141,648,632		probably null	Het
Snrnp200	G	T	2: 127,226,039	V819L	probably damaging	Het
Ssb	C	A	2: 69,870,440	A288E	probably damaging	Het
Syne2	A	G	12: 76,054,846	H638R	probably benign	Het
Tm7sf3	A	G	6: 146,626,200	S43P	probably benign	Het
Tmem200c	A	G	17: 68,842,186	H588R	probably benign	Het
Tnpo3	G	A	6: 29,560,174	R657*	probably null	Het
Traf6	T	C	2: 101,688,582	C139R	probably damaging	Het
Ubqln3	T	C	7: 104,142,755	I43V	probably damaging	Het
Usp32	A	G	11: 85,030,491	V699A	probably damaging	Het
Vmn2r103	T	C	17: 19,793,765	V273A	probably benign	Het
Vmn2r8	A	G	5: 108,803,241	S113P	probably benign	Het
Wdr7	T	A	18: 63,727,755	I161N	probably damaging	Het
Zfp474	A	T	18: 52,638,943	I223F	probably damaging	Het
Zfp583	A	G	7: 6,317,329	L228P	probably damaging	Het
Zfyve27	A	G	19: 42,177,417	T76A	possibly damaging	Het

Other mutations in Txnrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Txnrd1	APN	10	82875662	missense	probably damaging	1.00
IGL00644:Txnrd1	APN	10	82885176	splice site	probably benign
IGL01995:Txnrd1	APN	10	82877284	missense	probably damaging	1.00
IGL02167:Txnrd1	APN	10	82881911	missense	probably benign	0.01
IGL02368:Txnrd1	APN	10	82895974	splice site	probably null
IGL02500:Txnrd1	APN	10	82879217	missense	probably damaging	1.00
IGL02870:Txnrd1	APN	10	82895979	missense	probably benign	0.13
IGL03188:Txnrd1	APN	10	82885046	missense	possibly damaging	0.79
IGL03257:Txnrd1	APN	10	82885271	missense	probably benign	0.00
F6893:Txnrd1	UTSW	10	82866989	nonsense	probably null
R0092:Txnrd1	UTSW	10	82879802	missense	probably damaging	1.00
R2019:Txnrd1	UTSW	10	82877373	missense	probably benign	0.00
R2088:Txnrd1	UTSW	10	82883910	splice site	probably benign
R2101:Txnrd1	UTSW	10	82881739	missense	probably damaging	1.00
R2120:Txnrd1	UTSW	10	82887233	missense	possibly damaging	0.86
R2696:Txnrd1	UTSW	10	82885282	missense	probably benign	0.05
R4058:Txnrd1	UTSW	10	82885280	missense	probably benign	0.03
R4059:Txnrd1	UTSW	10	82885280	missense	probably benign	0.03
R4879:Txnrd1	UTSW	10	82881917	splice site	probably null
R5582:Txnrd1	UTSW	10	82895980	missense	possibly damaging	0.72
R6870:Txnrd1	UTSW	10	82873208	missense	probably benign	0.45
R6965:Txnrd1	UTSW	10	82881818	missense	probably benign	0.02
R7336:Txnrd1	UTSW	10	82873217	missense	probably benign	0.00
R7449:Txnrd1	UTSW	10	82885233	nonsense	probably null
R8350:Txnrd1	UTSW	10	82881925	missense	probably benign	0.02
R8369:Txnrd1	UTSW	10	82874646	missense	probably benign	0.01
R9201:Txnrd1	UTSW	10	82883987	missense	probably benign	0.00
RF019:Txnrd1	UTSW	10	82885100	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAGAGACGTTGGCTTGGTCG -3'
(R):5'- GCAAGAATCCTGGCCACTAC -3'

Sequencing Primer
(F):5'- AACGTAAAAGGGTTTGCTTTGC -3'
(R):5'- GAATCCTGGCCACTACTTTAAAAATC -3'

Posted On

2022-11-14