Incidental Mutation 'R9652:Usp32'
ID 735397
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9652 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85030491 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 699 (V699A)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: V699A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: V699A

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804
AA Change: V203A

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 G A 18: 61,743,361 T395M probably damaging Het
Akap8l T C 17: 32,338,809 N35D probably damaging Het
Atr T A 9: 95,874,834 L922Q probably damaging Het
B3gnt9 G T 8: 105,254,497 F86L probably damaging Het
Bmp1 T C 14: 70,477,920 D925G probably damaging Het
C77080 T C 4: 129,224,169 E279G possibly damaging Het
Camkmt A T 17: 85,452,285 R284S probably benign Het
Cavin3 G T 7: 105,482,097 H21Q probably damaging Het
Ccp110 A G 7: 118,735,330 H180R Het
Cdh23 A T 10: 60,331,356 V1837E probably damaging Het
Ces3b G T 8: 105,085,625 A169S probably damaging Het
Chpt1 T C 10: 88,489,637 N122S probably benign Het
Cramp1l C A 17: 24,982,809 K566N probably damaging Het
Ctbp2 C G 7: 133,014,204 R334P probably damaging Het
Cwh43 T C 5: 73,414,997 S193P probably benign Het
Dcstamp A T 15: 39,760,396 D469V probably benign Het
Dst T A 1: 34,180,377 I1966N probably benign Het
Eif3i G T 4: 129,595,301 F121L probably benign Het
Erbb2 T C 11: 98,435,986 S1074P probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbn2 A G 18: 58,013,650 probably null Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Gm2a T C 11: 55,108,938 V95A probably benign Het
Gp5 A C 16: 30,309,575 F94V probably damaging Het
Gramd4 G A 15: 86,131,959 E504K probably damaging Het
Gusb A G 5: 129,997,811 S450P probably damaging Het
Htr5a A G 5: 27,842,840 N131S possibly damaging Het
Itga2 G A 13: 114,884,455 P120L probably benign Het
Itpkb G T 1: 180,332,491 E61* probably null Het
Katnbl1 T A 2: 112,409,152 V232D probably damaging Het
Kifap3 T C 1: 163,862,088 L547P probably damaging Het
Krt6a C T 15: 101,690,685 V482M probably benign Het
Lrfn5 T A 12: 61,843,632 V569D probably damaging Het
Luzp2 A G 7: 55,052,832 T48A probably damaging Het
Mical2 G T 7: 112,346,789 R986L probably damaging Het
Mroh8 G A 2: 157,253,050 Q339* probably null Het
Msln A T 17: 25,749,068 V541E probably damaging Het
Muc16 T A 9: 18,586,882 M6590L probably benign Het
Nisch A T 14: 31,171,671 V1315E probably damaging Het
Nubp2 G A 17: 24,884,408 T165I probably damaging Het
Olfr1089 A T 2: 86,733,292 F107I probably damaging Het
Olfr13 A G 6: 43,174,057 M24V probably benign Het
Olfr57 T C 10: 79,035,396 I200T probably benign Het
Olfr682-ps1 A T 7: 105,126,778 N164K probably benign Het
Olfr820 T C 10: 130,017,940 I193T possibly damaging Het
Oog3 T G 4: 144,157,919 R482S probably benign Het
P3h4 A T 11: 100,413,673 C247* probably null Het
Palm2 G A 4: 57,710,125 A357T possibly damaging Het
Plch2 T A 4: 154,998,485 M569L probably benign Het
Plcl1 A G 1: 55,696,291 T264A probably benign Het
Rad51ap1 G T 6: 126,927,563 N178K probably benign Het
Rasa4 T C 5: 136,101,640 L340P probably damaging Het
Rassf10 A G 7: 112,955,577 T462A probably benign Het
Rlf G C 4: 121,150,668 L482V probably damaging Het
Robo1 T G 16: 73,024,442 S1357A possibly damaging Het
Rp1l1 T C 14: 64,032,265 S1767P probably damaging Het
Rpl3l T A 17: 24,728,354 L14Q probably damaging Het
Ryr3 T A 2: 112,804,702 T2024S possibly damaging Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sema6a T C 18: 47,249,185 Q765R probably damaging Het
Senp6 T A 9: 80,113,946 Y303N probably damaging Het
Sertad4 C T 1: 192,846,528 D327N probably damaging Het
Slc22a15 T A 3: 101,883,532 Y219F possibly damaging Het
Slco1b2 T G 6: 141,648,632 probably null Het
Snrnp200 G T 2: 127,226,039 V819L probably damaging Het
Ssb C A 2: 69,870,440 A288E probably damaging Het
Syne2 A G 12: 76,054,846 H638R probably benign Het
Tm7sf3 A G 6: 146,626,200 S43P probably benign Het
Tmem200c A G 17: 68,842,186 H588R probably benign Het
Tnpo3 G A 6: 29,560,174 R657* probably null Het
Traf6 T C 2: 101,688,582 C139R probably damaging Het
Txnrd1 C A 10: 82,884,556 N424K possibly damaging Het
Ubqln3 T C 7: 104,142,755 I43V probably damaging Het
Vmn2r103 T C 17: 19,793,765 V273A probably benign Het
Vmn2r8 A G 5: 108,803,241 S113P probably benign Het
Wdr7 T A 18: 63,727,755 I161N probably damaging Het
Zfp474 A T 18: 52,638,943 I223F probably damaging Het
Zfp583 A G 7: 6,317,329 L228P probably damaging Het
Zfyve27 A G 19: 42,177,417 T76A possibly damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
R9723:Usp32 UTSW 11 85044710 nonsense probably null
R9757:Usp32 UTSW 11 85077329 nonsense probably null
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTCCTCGGTTAGCCTAAGG -3'
(R):5'- CCTTCACTTTGGCACCTAAACTATAG -3'

Sequencing Primer
(F):5'- GATACTAGAAGTTCAGTGGGTCTAC -3'
(R):5'- TGAACAACTAAGTATCCGTAACATG -3'
Posted On 2022-11-14