Incidental Mutation 'R9652:Itga2'
ID 735402
Institutional Source Beutler Lab
Gene Symbol Itga2
Ensembl Gene ENSMUSG00000015533
Gene Name integrin alpha 2
Synonyms VLA-2 receptor, alpha 2 subunit, DX5, CD49B
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_008396.2; MGI: 96600

Essential gene? Non essential (E-score: 0.000) question?
Stock # R9652 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 114833081-114932100 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 114884455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 120 (P120L)
Ref Sequence ENSEMBL: ENSMUSP00000053891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056117] [ENSMUST00000224204]
AlphaFold Q62469
Predicted Effect probably benign
Transcript: ENSMUST00000056117
AA Change: P120L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533
AA Change: P120L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Int_alpha 41 96 4.91e-4 SMART
VWA 169 359 2.42e-39 SMART
Blast:VWA 364 424 4e-26 BLAST
Int_alpha 430 481 2.59e-3 SMART
Int_alpha 484 541 3.5e-9 SMART
Int_alpha 547 602 3.11e-15 SMART
Int_alpha 611 669 2.52e-1 SMART
low complexity region 890 910 N/A INTRINSIC
transmembrane domain 1129 1151 N/A INTRINSIC
Pfam:Integrin_alpha 1152 1166 9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224204
AA Change: P103L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 2675420;2183401
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 G A 18: 61,743,361 T395M probably damaging Het
Akap8l T C 17: 32,338,809 N35D probably damaging Het
Atr T A 9: 95,874,834 L922Q probably damaging Het
B3gnt9 G T 8: 105,254,497 F86L probably damaging Het
Bmp1 T C 14: 70,477,920 D925G probably damaging Het
C77080 T C 4: 129,224,169 E279G possibly damaging Het
Camkmt A T 17: 85,452,285 R284S probably benign Het
Cavin3 G T 7: 105,482,097 H21Q probably damaging Het
Ccp110 A G 7: 118,735,330 H180R Het
Cdh23 A T 10: 60,331,356 V1837E probably damaging Het
Ces3b G T 8: 105,085,625 A169S probably damaging Het
Chpt1 T C 10: 88,489,637 N122S probably benign Het
Cramp1l C A 17: 24,982,809 K566N probably damaging Het
Ctbp2 C G 7: 133,014,204 R334P probably damaging Het
Cwh43 T C 5: 73,414,997 S193P probably benign Het
Dcstamp A T 15: 39,760,396 D469V probably benign Het
Dst T A 1: 34,180,377 I1966N probably benign Het
Eif3i G T 4: 129,595,301 F121L probably benign Het
Erbb2 T C 11: 98,435,986 S1074P probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbn2 A G 18: 58,013,650 probably null Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Gm2a T C 11: 55,108,938 V95A probably benign Het
Gp5 A C 16: 30,309,575 F94V probably damaging Het
Gramd4 G A 15: 86,131,959 E504K probably damaging Het
Gusb A G 5: 129,997,811 S450P probably damaging Het
Htr5a A G 5: 27,842,840 N131S possibly damaging Het
Itpkb G T 1: 180,332,491 E61* probably null Het
Katnbl1 T A 2: 112,409,152 V232D probably damaging Het
Kifap3 T C 1: 163,862,088 L547P probably damaging Het
Krt6a C T 15: 101,690,685 V482M probably benign Het
Lrfn5 T A 12: 61,843,632 V569D probably damaging Het
Luzp2 A G 7: 55,052,832 T48A probably damaging Het
Mical2 G T 7: 112,346,789 R986L probably damaging Het
Mroh8 G A 2: 157,253,050 Q339* probably null Het
Msln A T 17: 25,749,068 V541E probably damaging Het
Muc16 T A 9: 18,586,882 M6590L probably benign Het
Nisch A T 14: 31,171,671 V1315E probably damaging Het
Nubp2 G A 17: 24,884,408 T165I probably damaging Het
Olfr1089 A T 2: 86,733,292 F107I probably damaging Het
Olfr13 A G 6: 43,174,057 M24V probably benign Het
Olfr57 T C 10: 79,035,396 I200T probably benign Het
Olfr682-ps1 A T 7: 105,126,778 N164K probably benign Het
Olfr820 T C 10: 130,017,940 I193T possibly damaging Het
Oog3 T G 4: 144,157,919 R482S probably benign Het
P3h4 A T 11: 100,413,673 C247* probably null Het
Palm2 G A 4: 57,710,125 A357T possibly damaging Het
Plch2 T A 4: 154,998,485 M569L probably benign Het
Plcl1 A G 1: 55,696,291 T264A probably benign Het
Rad51ap1 G T 6: 126,927,563 N178K probably benign Het
Rasa4 T C 5: 136,101,640 L340P probably damaging Het
Rassf10 A G 7: 112,955,577 T462A probably benign Het
Rlf G C 4: 121,150,668 L482V probably damaging Het
Robo1 T G 16: 73,024,442 S1357A possibly damaging Het
Rp1l1 T C 14: 64,032,265 S1767P probably damaging Het
Rpl3l T A 17: 24,728,354 L14Q probably damaging Het
Ryr3 T A 2: 112,804,702 T2024S possibly damaging Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sema6a T C 18: 47,249,185 Q765R probably damaging Het
Senp6 T A 9: 80,113,946 Y303N probably damaging Het
Sertad4 C T 1: 192,846,528 D327N probably damaging Het
Slc22a15 T A 3: 101,883,532 Y219F possibly damaging Het
Slco1b2 T G 6: 141,648,632 probably null Het
Snrnp200 G T 2: 127,226,039 V819L probably damaging Het
Ssb C A 2: 69,870,440 A288E probably damaging Het
Syne2 A G 12: 76,054,846 H638R probably benign Het
Tm7sf3 A G 6: 146,626,200 S43P probably benign Het
Tmem200c A G 17: 68,842,186 H588R probably benign Het
Tnpo3 G A 6: 29,560,174 R657* probably null Het
Traf6 T C 2: 101,688,582 C139R probably damaging Het
Txnrd1 C A 10: 82,884,556 N424K possibly damaging Het
Ubqln3 T C 7: 104,142,755 I43V probably damaging Het
Usp32 A G 11: 85,030,491 V699A probably damaging Het
Vmn2r103 T C 17: 19,793,765 V273A probably benign Het
Vmn2r8 A G 5: 108,803,241 S113P probably benign Het
Wdr7 T A 18: 63,727,755 I161N probably damaging Het
Zfp474 A T 18: 52,638,943 I223F probably damaging Het
Zfp583 A G 7: 6,317,329 L228P probably damaging Het
Zfyve27 A G 19: 42,177,417 T76A possibly damaging Het
Other mutations in Itga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Itga2 APN 13 114877625 missense probably damaging 0.99
IGL01481:Itga2 APN 13 114859632 missense possibly damaging 0.63
IGL01666:Itga2 APN 13 114837091 critical splice donor site probably null
IGL01730:Itga2 APN 13 114854411 splice site probably benign
IGL01965:Itga2 APN 13 114848064 splice site probably benign
IGL01987:Itga2 APN 13 114847946 nonsense probably null
IGL02334:Itga2 APN 13 114865309 critical splice donor site probably null
IGL02381:Itga2 APN 13 114856722 missense probably damaging 1.00
IGL02562:Itga2 APN 13 114836570 unclassified probably benign
IGL03191:Itga2 APN 13 114836484 unclassified probably benign
IGL03209:Itga2 APN 13 114880632 missense probably damaging 1.00
P0007:Itga2 UTSW 13 114866199 missense probably damaging 1.00
R0023:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0023:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0025:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0029:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0062:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0062:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0149:Itga2 UTSW 13 114836579 unclassified probably benign
R0152:Itga2 UTSW 13 114866314 missense probably benign 0.06
R0496:Itga2 UTSW 13 114853899 missense probably benign 0.00
R0502:Itga2 UTSW 13 114845856 missense probably benign 0.15
R0599:Itga2 UTSW 13 114856650 splice site probably benign
R0688:Itga2 UTSW 13 114839554 missense probably benign 0.00
R0704:Itga2 UTSW 13 114862375 missense possibly damaging 0.91
R0760:Itga2 UTSW 13 114859632 missense possibly damaging 0.63
R0811:Itga2 UTSW 13 114870614 missense possibly damaging 0.92
R0812:Itga2 UTSW 13 114870614 missense possibly damaging 0.92
R0836:Itga2 UTSW 13 114856679 missense probably damaging 0.99
R1196:Itga2 UTSW 13 114866155 critical splice donor site probably null
R1546:Itga2 UTSW 13 114849420 missense possibly damaging 0.63
R1639:Itga2 UTSW 13 114857296 missense probably benign 0.00
R1834:Itga2 UTSW 13 114856726 missense probably damaging 0.98
R1834:Itga2 UTSW 13 114856727 missense probably damaging 1.00
R2180:Itga2 UTSW 13 114849381 missense possibly damaging 0.67
R2190:Itga2 UTSW 13 114870605 missense probably benign 0.05
R2518:Itga2 UTSW 13 114881042 missense probably damaging 1.00
R3885:Itga2 UTSW 13 114869299 missense probably benign 0.35
R3962:Itga2 UTSW 13 114839518 missense probably damaging 0.99
R4094:Itga2 UTSW 13 114870625 missense probably benign 0.01
R4193:Itga2 UTSW 13 114886649 nonsense probably null
R4290:Itga2 UTSW 13 114866173 missense probably damaging 0.98
R4459:Itga2 UTSW 13 114843483 missense probably damaging 0.97
R4460:Itga2 UTSW 13 114843483 missense probably damaging 0.97
R4628:Itga2 UTSW 13 114877693 missense probably benign 0.03
R4655:Itga2 UTSW 13 114873269 missense probably benign 0.00
R4716:Itga2 UTSW 13 114857373 missense probably damaging 0.98
R4896:Itga2 UTSW 13 114853766 nonsense probably null
R5093:Itga2 UTSW 13 114856181 missense probably benign 0.00
R5488:Itga2 UTSW 13 114843435 missense probably damaging 1.00
R5489:Itga2 UTSW 13 114843435 missense probably damaging 1.00
R5743:Itga2 UTSW 13 114884506 missense probably damaging 1.00
R5767:Itga2 UTSW 13 114839570 missense possibly damaging 0.88
R5790:Itga2 UTSW 13 114868206 missense probably benign 0.02
R5923:Itga2 UTSW 13 114884519 missense probably benign 0.02
R6163:Itga2 UTSW 13 114866190 missense probably damaging 1.00
R6227:Itga2 UTSW 13 114839561 missense probably benign 0.30
R6278:Itga2 UTSW 13 114845888 missense probably benign 0.05
R6283:Itga2 UTSW 13 114869250 missense probably damaging 1.00
R6332:Itga2 UTSW 13 114843473 missense probably benign
R6510:Itga2 UTSW 13 114873280 missense probably damaging 1.00
R6742:Itga2 UTSW 13 114836525 missense possibly damaging 0.93
R6869:Itga2 UTSW 13 114875537 splice site probably null
R7073:Itga2 UTSW 13 114859613 missense probably damaging 1.00
R7111:Itga2 UTSW 13 114900530 missense unknown
R7236:Itga2 UTSW 13 114877691 missense probably benign
R7269:Itga2 UTSW 13 114886689 nonsense probably null
R7296:Itga2 UTSW 13 114857394 splice site probably null
R7350:Itga2 UTSW 13 114837202 missense probably damaging 0.98
R7375:Itga2 UTSW 13 114869217 missense probably benign 0.06
R7501:Itga2 UTSW 13 114875559 missense probably damaging 1.00
R7687:Itga2 UTSW 13 114866260 missense probably damaging 1.00
R7766:Itga2 UTSW 13 114853891 missense probably benign
R7810:Itga2 UTSW 13 114866179 missense probably benign 0.15
R8038:Itga2 UTSW 13 114853755 missense probably damaging 1.00
R8948:Itga2 UTSW 13 114873330 missense probably damaging 1.00
R9132:Itga2 UTSW 13 114877762 nonsense probably null
R9153:Itga2 UTSW 13 114865405 missense probably benign 0.00
R9159:Itga2 UTSW 13 114877762 nonsense probably null
R9651:Itga2 UTSW 13 114884455 missense probably benign 0.00
R9653:Itga2 UTSW 13 114884455 missense probably benign 0.00
Z1088:Itga2 UTSW 13 114857332 missense possibly damaging 0.46
Z1177:Itga2 UTSW 13 114853701 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGCGAATAATCAAGAAGGCTCTATG -3'
(R):5'- ATGCTTGTTCCGGGATATGC -3'

Sequencing Primer
(F):5'- GAAGGCTCTATGCAAACACTG -3'
(R):5'- CCGGGATATGCTATAGTATACTCC -3'
Posted On 2022-11-14