Incidental Mutation 'R9652:Vmn2r103'
ID 735412
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9652 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19773363-19812536 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19793765 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 273 (V273A)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: V273A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: V273A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 G A 18: 61,743,361 T395M probably damaging Het
Akap8l T C 17: 32,338,809 N35D probably damaging Het
Atr T A 9: 95,874,834 L922Q probably damaging Het
B3gnt9 G T 8: 105,254,497 F86L probably damaging Het
Bmp1 T C 14: 70,477,920 D925G probably damaging Het
C77080 T C 4: 129,224,169 E279G possibly damaging Het
Camkmt A T 17: 85,452,285 R284S probably benign Het
Cavin3 G T 7: 105,482,097 H21Q probably damaging Het
Ccp110 A G 7: 118,735,330 H180R Het
Cdh23 A T 10: 60,331,356 V1837E probably damaging Het
Ces3b G T 8: 105,085,625 A169S probably damaging Het
Chpt1 T C 10: 88,489,637 N122S probably benign Het
Cramp1l C A 17: 24,982,809 K566N probably damaging Het
Ctbp2 C G 7: 133,014,204 R334P probably damaging Het
Cwh43 T C 5: 73,414,997 S193P probably benign Het
Dcstamp A T 15: 39,760,396 D469V probably benign Het
Dst T A 1: 34,180,377 I1966N probably benign Het
Eif3i G T 4: 129,595,301 F121L probably benign Het
Erbb2 T C 11: 98,435,986 S1074P probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbn2 A G 18: 58,013,650 probably null Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Gm2a T C 11: 55,108,938 V95A probably benign Het
Gp5 A C 16: 30,309,575 F94V probably damaging Het
Gramd4 G A 15: 86,131,959 E504K probably damaging Het
Gusb A G 5: 129,997,811 S450P probably damaging Het
Htr5a A G 5: 27,842,840 N131S possibly damaging Het
Itga2 G A 13: 114,884,455 P120L probably benign Het
Itpkb G T 1: 180,332,491 E61* probably null Het
Katnbl1 T A 2: 112,409,152 V232D probably damaging Het
Kifap3 T C 1: 163,862,088 L547P probably damaging Het
Krt6a C T 15: 101,690,685 V482M probably benign Het
Lrfn5 T A 12: 61,843,632 V569D probably damaging Het
Luzp2 A G 7: 55,052,832 T48A probably damaging Het
Mical2 G T 7: 112,346,789 R986L probably damaging Het
Mroh8 G A 2: 157,253,050 Q339* probably null Het
Msln A T 17: 25,749,068 V541E probably damaging Het
Muc16 T A 9: 18,586,882 M6590L probably benign Het
Nisch A T 14: 31,171,671 V1315E probably damaging Het
Nubp2 G A 17: 24,884,408 T165I probably damaging Het
Olfr1089 A T 2: 86,733,292 F107I probably damaging Het
Olfr13 A G 6: 43,174,057 M24V probably benign Het
Olfr57 T C 10: 79,035,396 I200T probably benign Het
Olfr682-ps1 A T 7: 105,126,778 N164K probably benign Het
Olfr820 T C 10: 130,017,940 I193T possibly damaging Het
Oog3 T G 4: 144,157,919 R482S probably benign Het
P3h4 A T 11: 100,413,673 C247* probably null Het
Palm2 G A 4: 57,710,125 A357T possibly damaging Het
Plch2 T A 4: 154,998,485 M569L probably benign Het
Plcl1 A G 1: 55,696,291 T264A probably benign Het
Rad51ap1 G T 6: 126,927,563 N178K probably benign Het
Rasa4 T C 5: 136,101,640 L340P probably damaging Het
Rassf10 A G 7: 112,955,577 T462A probably benign Het
Rlf G C 4: 121,150,668 L482V probably damaging Het
Robo1 T G 16: 73,024,442 S1357A possibly damaging Het
Rp1l1 T C 14: 64,032,265 S1767P probably damaging Het
Rpl3l T A 17: 24,728,354 L14Q probably damaging Het
Ryr3 T A 2: 112,804,702 T2024S possibly damaging Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sema6a T C 18: 47,249,185 Q765R probably damaging Het
Senp6 T A 9: 80,113,946 Y303N probably damaging Het
Sertad4 C T 1: 192,846,528 D327N probably damaging Het
Slc22a15 T A 3: 101,883,532 Y219F possibly damaging Het
Slco1b2 T G 6: 141,648,632 probably null Het
Snrnp200 G T 2: 127,226,039 V819L probably damaging Het
Ssb C A 2: 69,870,440 A288E probably damaging Het
Syne2 A G 12: 76,054,846 H638R probably benign Het
Tm7sf3 A G 6: 146,626,200 S43P probably benign Het
Tmem200c A G 17: 68,842,186 H588R probably benign Het
Tnpo3 G A 6: 29,560,174 R657* probably null Het
Traf6 T C 2: 101,688,582 C139R probably damaging Het
Txnrd1 C A 10: 82,884,556 N424K possibly damaging Het
Ubqln3 T C 7: 104,142,755 I43V probably damaging Het
Usp32 A G 11: 85,030,491 V699A probably damaging Het
Vmn2r8 A G 5: 108,803,241 S113P probably benign Het
Wdr7 T A 18: 63,727,755 I161N probably damaging Het
Zfp474 A T 18: 52,638,943 I223F probably damaging Het
Zfp583 A G 7: 6,317,329 L228P probably damaging Het
Zfyve27 A G 19: 42,177,417 T76A possibly damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 19812052 missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 19794214 missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 19799249 missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 19793497 missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 19811796 missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 19811943 missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 19812384 missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 19811896 missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 19811659 missense possibly damaging 0.70
R9680:Vmn2r103 UTSW 17 19799263 nonsense probably null
R9743:Vmn2r103 UTSW 17 19812213 missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGGTTGGTCTCATACTCCC -3'
(R):5'- GCCACAGCTTAGGAAGATAAATATC -3'

Sequencing Primer
(F):5'- GGTTGGTCTCATACTCCCTGATGAC -3'
(R):5'- AGGCTTCCATGGAATGAG -3'
Posted On 2022-11-14