Mutagenetix > Incidental Mutation

Incidental Mutation 'R9652:Rpl3l'

735413

Institutional Source

Beutler Lab

Gene Symbol

Rpl3l

Ensembl Gene

ENSMUSG00000002500

Gene Name

ribosomal protein L3-like

Synonyms

1110057H16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R9652 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24727820-24736143 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24728354 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 14 (L14Q)

Ref Sequence

ENSEMBL: ENSMUSP00000129325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045186] [ENSMUST00000045602] [ENSMUST00000135708] [ENSMUST00000170239] [ENSMUST00000183214]

AlphaFold

E9PWZ3

Predicted Effect

probably benign
Transcript: ENSMUST00000045186

SMART Domains

Protein: ENSMUSP00000038326
Gene: ENSMUSG00000002500

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L3	1	181	5.1e-72	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000045602

SMART Domains

Protein: ENSMUSP00000043543
Gene: ENSMUSG00000040048

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
Pfam:NDUFB10	42	168	2.1e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000135708

SMART Domains

Protein: ENSMUSP00000120091
Gene: ENSMUSG00000040048

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
Pfam:NDUFB10	54	149	7.1e-40	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170239
AA Change: L14Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129325
Gene: ENSMUSG00000002500
AA Change: L14Q

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L3	1	375	1.2e-178	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183214

SMART Domains

Protein: ENSMUSP00000138489
Gene: ENSMUSG00000002500

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L3	1	133	1.1e-43	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.6%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares sequence similarity with ribosomal protein L3. The protein belongs to the L3P family of ribosomal proteins. Unlike the ubiquitous expression of ribosomal protein genes, this gene has a tissue-specific pattern of expression, with the highest levels of expression in skeletal muscle and heart. It is not currently known whether the encoded protein is a functional ribosomal protein or whether it has evolved a function that is independent of the ribosome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afap1l1	G	A	18: 61,743,361	T395M	probably damaging	Het
Akap8l	T	C	17: 32,338,809	N35D	probably damaging	Het
Atr	T	A	9: 95,874,834	L922Q	probably damaging	Het
B3gnt9	G	T	8: 105,254,497	F86L	probably damaging	Het
Bmp1	T	C	14: 70,477,920	D925G	probably damaging	Het
C77080	T	C	4: 129,224,169	E279G	possibly damaging	Het
Camkmt	A	T	17: 85,452,285	R284S	probably benign	Het
Cavin3	G	T	7: 105,482,097	H21Q	probably damaging	Het
Ccp110	A	G	7: 118,735,330	H180R		Het
Cdh23	A	T	10: 60,331,356	V1837E	probably damaging	Het
Ces3b	G	T	8: 105,085,625	A169S	probably damaging	Het
Chpt1	T	C	10: 88,489,637	N122S	probably benign	Het
Cramp1l	C	A	17: 24,982,809	K566N	probably damaging	Het
Ctbp2	C	G	7: 133,014,204	R334P	probably damaging	Het
Cwh43	T	C	5: 73,414,997	S193P	probably benign	Het
Dcstamp	A	T	15: 39,760,396	D469V	probably benign	Het
Dst	T	A	1: 34,180,377	I1966N	probably benign	Het
Eif3i	G	T	4: 129,595,301	F121L	probably benign	Het
Erbb2	T	C	11: 98,435,986	S1074P	probably damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fbn2	A	G	18: 58,013,650		probably null	Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Gm2a	T	C	11: 55,108,938	V95A	probably benign	Het
Gp5	A	C	16: 30,309,575	F94V	probably damaging	Het
Gramd4	G	A	15: 86,131,959	E504K	probably damaging	Het
Gusb	A	G	5: 129,997,811	S450P	probably damaging	Het
Htr5a	A	G	5: 27,842,840	N131S	possibly damaging	Het
Itga2	G	A	13: 114,884,455	P120L	probably benign	Het
Itpkb	G	T	1: 180,332,491	E61*	probably null	Het
Katnbl1	T	A	2: 112,409,152	V232D	probably damaging	Het
Kifap3	T	C	1: 163,862,088	L547P	probably damaging	Het
Krt6a	C	T	15: 101,690,685	V482M	probably benign	Het
Lrfn5	T	A	12: 61,843,632	V569D	probably damaging	Het
Luzp2	A	G	7: 55,052,832	T48A	probably damaging	Het
Mical2	G	T	7: 112,346,789	R986L	probably damaging	Het
Mroh8	G	A	2: 157,253,050	Q339*	probably null	Het
Msln	A	T	17: 25,749,068	V541E	probably damaging	Het
Muc16	T	A	9: 18,586,882	M6590L	probably benign	Het
Nisch	A	T	14: 31,171,671	V1315E	probably damaging	Het
Nubp2	G	A	17: 24,884,408	T165I	probably damaging	Het
Olfr1089	A	T	2: 86,733,292	F107I	probably damaging	Het
Olfr13	A	G	6: 43,174,057	M24V	probably benign	Het
Olfr57	T	C	10: 79,035,396	I200T	probably benign	Het
Olfr682-ps1	A	T	7: 105,126,778	N164K	probably benign	Het
Olfr820	T	C	10: 130,017,940	I193T	possibly damaging	Het
Oog3	T	G	4: 144,157,919	R482S	probably benign	Het
P3h4	A	T	11: 100,413,673	C247*	probably null	Het
Palm2	G	A	4: 57,710,125	A357T	possibly damaging	Het
Plch2	T	A	4: 154,998,485	M569L	probably benign	Het
Plcl1	A	G	1: 55,696,291	T264A	probably benign	Het
Rad51ap1	G	T	6: 126,927,563	N178K	probably benign	Het
Rasa4	T	C	5: 136,101,640	L340P	probably damaging	Het
Rassf10	A	G	7: 112,955,577	T462A	probably benign	Het
Rlf	G	C	4: 121,150,668	L482V	probably damaging	Het
Robo1	T	G	16: 73,024,442	S1357A	possibly damaging	Het
Rp1l1	T	C	14: 64,032,265	S1767P	probably damaging	Het
Ryr3	T	A	2: 112,804,702	T2024S	possibly damaging	Het
Sbf2	T	C	7: 110,441,495	Q375R	possibly damaging	Het
Sema6a	T	C	18: 47,249,185	Q765R	probably damaging	Het
Senp6	T	A	9: 80,113,946	Y303N	probably damaging	Het
Sertad4	C	T	1: 192,846,528	D327N	probably damaging	Het
Slc22a15	T	A	3: 101,883,532	Y219F	possibly damaging	Het
Slco1b2	T	G	6: 141,648,632		probably null	Het
Snrnp200	G	T	2: 127,226,039	V819L	probably damaging	Het
Ssb	C	A	2: 69,870,440	A288E	probably damaging	Het
Syne2	A	G	12: 76,054,846	H638R	probably benign	Het
Tm7sf3	A	G	6: 146,626,200	S43P	probably benign	Het
Tmem200c	A	G	17: 68,842,186	H588R	probably benign	Het
Tnpo3	G	A	6: 29,560,174	R657*	probably null	Het
Traf6	T	C	2: 101,688,582	C139R	probably damaging	Het
Txnrd1	C	A	10: 82,884,556	N424K	possibly damaging	Het
Ubqln3	T	C	7: 104,142,755	I43V	probably damaging	Het
Usp32	A	G	11: 85,030,491	V699A	probably damaging	Het
Vmn2r103	T	C	17: 19,793,765	V273A	probably benign	Het
Vmn2r8	A	G	5: 108,803,241	S113P	probably benign	Het
Wdr7	T	A	18: 63,727,755	I161N	probably damaging	Het
Zfp474	A	T	18: 52,638,943	I223F	probably damaging	Het
Zfp583	A	G	7: 6,317,329	L228P	probably damaging	Het
Zfyve27	A	G	19: 42,177,417	T76A	possibly damaging	Het

Other mutations in Rpl3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Rpl3l	APN	17	24735471	missense	probably damaging	0.96
IGL01364:Rpl3l	APN	17	24732430	missense	probably benign	0.07
IGL02009:Rpl3l	APN	17	24732433	missense	probably damaging	0.98
IGL02422:Rpl3l	APN	17	24733988	nonsense	probably null
IGL03309:Rpl3l	APN	17	24736024	missense	possibly damaging	0.64
stringer	UTSW	17	24735481	missense	probably damaging	1.00
PIT4468001:Rpl3l	UTSW	17	24735483	missense	probably benign	0.00
R1466:Rpl3l	UTSW	17	24730871	missense	probably benign
R1466:Rpl3l	UTSW	17	24730871	missense	probably benign
R1782:Rpl3l	UTSW	17	24733456	missense	probably benign	0.02
R2019:Rpl3l	UTSW	17	24735516	unclassified	probably benign
R2509:Rpl3l	UTSW	17	24732386	missense	possibly damaging	0.94
R3844:Rpl3l	UTSW	17	24733942	missense	probably benign	0.02
R4574:Rpl3l	UTSW	17	24734010	missense	possibly damaging	0.70
R4675:Rpl3l	UTSW	17	24733610	missense	probably benign	0.43
R5097:Rpl3l	UTSW	17	24733461	missense	probably damaging	1.00
R5106:Rpl3l	UTSW	17	24732437	missense	probably damaging	1.00
R5187:Rpl3l	UTSW	17	24732455	missense	possibly damaging	0.95
R6073:Rpl3l	UTSW	17	24730887	missense	probably benign
R6295:Rpl3l	UTSW	17	24733992	missense	probably benign
R7624:Rpl3l	UTSW	17	24732427	missense	probably benign
R7655:Rpl3l	UTSW	17	24730986	missense	probably benign	0.37
R7656:Rpl3l	UTSW	17	24730986	missense	probably benign	0.37
R7834:Rpl3l	UTSW	17	24733463	missense	possibly damaging	0.58
R8527:Rpl3l	UTSW	17	24735780	missense	probably damaging	1.00
R8542:Rpl3l	UTSW	17	24735780	missense	probably damaging	1.00
R8792:Rpl3l	UTSW	17	24728473	missense	possibly damaging	0.73
R8840:Rpl3l	UTSW	17	24733737	missense	probably damaging	0.99
R8867:Rpl3l	UTSW	17	24735481	missense	probably damaging	1.00
R9046:Rpl3l	UTSW	17	24728461	missense	probably damaging	1.00
R9258:Rpl3l	UTSW	17	24732473	critical splice donor site	probably null
R9436:Rpl3l	UTSW	17	24728326	nonsense	probably null
R9651:Rpl3l	UTSW	17	24728354	missense	probably damaging	1.00
Z1177:Rpl3l	UTSW	17	24728398	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTATATGGATGAGGTAGCACCG -3'
(R):5'- AAGATTCTATTCCCAGCTCTGC -3'

Sequencing Primer
(F):5'- AGGTAGCACCGAGGACTGC -3'
(R):5'- ATTCCCAGCTCTGCCGTGTG -3'

Posted On

2022-11-14