Incidental Mutation 'R9652:Cramp1'
ID 735415
Institutional Source Beutler Lab
Gene Symbol Cramp1
Ensembl Gene ENSMUSG00000038002
Gene Name cramped chromatin regulator 1
Synonyms 5830477H08Rik, Tce4, Cramp1l
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9652 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 25180200-25234762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 25201783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 566 (K566N)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
AlphaFold Q6PG95
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: K566N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: K566N

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 G A 18: 61,876,432 (GRCm39) T395M probably damaging Het
Akap8l T C 17: 32,557,783 (GRCm39) N35D probably damaging Het
Atr T A 9: 95,756,887 (GRCm39) L922Q probably damaging Het
B3gnt9 G T 8: 105,981,129 (GRCm39) F86L probably damaging Het
Bmp1 T C 14: 70,715,360 (GRCm39) D925G probably damaging Het
Camkmt A T 17: 85,759,713 (GRCm39) R284S probably benign Het
Cavin3 G T 7: 105,131,304 (GRCm39) H21Q probably damaging Het
Ccp110 A G 7: 118,334,553 (GRCm39) H180R Het
Cdh23 A T 10: 60,167,135 (GRCm39) V1837E probably damaging Het
Ces3b G T 8: 105,812,257 (GRCm39) A169S probably damaging Het
Chpt1 T C 10: 88,325,499 (GRCm39) N122S probably benign Het
Ctbp2 C G 7: 132,615,933 (GRCm39) R334P probably damaging Het
Cwh43 T C 5: 73,572,340 (GRCm39) S193P probably benign Het
Dcstamp A T 15: 39,623,792 (GRCm39) D469V probably benign Het
Dst T A 1: 34,219,458 (GRCm39) I1966N probably benign Het
Eif3i G T 4: 129,489,094 (GRCm39) F121L probably benign Het
Erbb2 T C 11: 98,326,812 (GRCm39) S1074P probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbn2 A G 18: 58,146,722 (GRCm39) probably null Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Gm2a T C 11: 54,999,764 (GRCm39) V95A probably benign Het
Gp5 A C 16: 30,128,393 (GRCm39) F94V probably damaging Het
Gramd4 G A 15: 86,016,160 (GRCm39) E504K probably damaging Het
Gusb A G 5: 130,026,652 (GRCm39) S450P probably damaging Het
Htr5a A G 5: 28,047,838 (GRCm39) N131S possibly damaging Het
Itga2 G A 13: 115,020,991 (GRCm39) P120L probably benign Het
Itpkb G T 1: 180,160,056 (GRCm39) E61* probably null Het
Katnbl1 T A 2: 112,239,497 (GRCm39) V232D probably damaging Het
Kifap3 T C 1: 163,689,657 (GRCm39) L547P probably damaging Het
Krt6a C T 15: 101,599,120 (GRCm39) V482M probably benign Het
Lrfn5 T A 12: 61,890,418 (GRCm39) V569D probably damaging Het
Luzp2 A G 7: 54,702,580 (GRCm39) T48A probably damaging Het
Mical2 G T 7: 111,945,996 (GRCm39) R986L probably damaging Het
Mroh8 G A 2: 157,094,970 (GRCm39) Q339* probably null Het
Msln A T 17: 25,968,042 (GRCm39) V541E probably damaging Het
Muc16 T A 9: 18,498,178 (GRCm39) M6590L probably benign Het
Nhsl3 T C 4: 129,117,962 (GRCm39) E279G possibly damaging Het
Nisch A T 14: 30,893,628 (GRCm39) V1315E probably damaging Het
Nubp2 G A 17: 25,103,382 (GRCm39) T165I probably damaging Het
Oog3 T G 4: 143,884,489 (GRCm39) R482S probably benign Het
Or2a7 A G 6: 43,150,991 (GRCm39) M24V probably benign Het
Or56a42-ps1 A T 7: 104,775,985 (GRCm39) N164K probably benign Het
Or6c33 T C 10: 129,853,809 (GRCm39) I193T possibly damaging Het
Or7a41 T C 10: 78,871,230 (GRCm39) I200T probably benign Het
Or8k39 A T 2: 86,563,636 (GRCm39) F107I probably damaging Het
P3h4 A T 11: 100,304,499 (GRCm39) C247* probably null Het
Pakap G A 4: 57,710,125 (GRCm39) A357T possibly damaging Het
Plch2 T A 4: 155,082,942 (GRCm39) M569L probably benign Het
Plcl1 A G 1: 55,735,450 (GRCm39) T264A probably benign Het
Rad51ap1 G T 6: 126,904,526 (GRCm39) N178K probably benign Het
Rasa4 T C 5: 136,130,494 (GRCm39) L340P probably damaging Het
Rassf10 A G 7: 112,554,784 (GRCm39) T462A probably benign Het
Rlf G C 4: 121,007,865 (GRCm39) L482V probably damaging Het
Robo1 T G 16: 72,821,330 (GRCm39) S1357A possibly damaging Het
Rp1l1 T C 14: 64,269,714 (GRCm39) S1767P probably damaging Het
Rpl3l T A 17: 24,947,328 (GRCm39) L14Q probably damaging Het
Ryr3 T A 2: 112,635,047 (GRCm39) T2024S possibly damaging Het
Sbf2 T C 7: 110,040,702 (GRCm39) Q375R possibly damaging Het
Sema6a T C 18: 47,382,252 (GRCm39) Q765R probably damaging Het
Senp6 T A 9: 80,021,228 (GRCm39) Y303N probably damaging Het
Sertad4 C T 1: 192,528,836 (GRCm39) D327N probably damaging Het
Slc22a15 T A 3: 101,790,848 (GRCm39) Y219F possibly damaging Het
Slco1b2 T G 6: 141,594,358 (GRCm39) probably null Het
Snrnp200 G T 2: 127,067,959 (GRCm39) V819L probably damaging Het
Ssb C A 2: 69,700,784 (GRCm39) A288E probably damaging Het
Syne2 A G 12: 76,101,620 (GRCm39) H638R probably benign Het
Tm7sf3 A G 6: 146,527,698 (GRCm39) S43P probably benign Het
Tmem200c A G 17: 69,149,181 (GRCm39) H588R probably benign Het
Tnpo3 G A 6: 29,560,173 (GRCm39) R657* probably null Het
Traf6 T C 2: 101,518,927 (GRCm39) C139R probably damaging Het
Txnrd1 C A 10: 82,720,390 (GRCm39) N424K possibly damaging Het
Ubqln3 T C 7: 103,791,962 (GRCm39) I43V probably damaging Het
Usp32 A G 11: 84,921,317 (GRCm39) V699A probably damaging Het
Vmn2r103 T C 17: 20,014,027 (GRCm39) V273A probably benign Het
Vmn2r8 A G 5: 108,951,107 (GRCm39) S113P probably benign Het
Wdr7 T A 18: 63,860,826 (GRCm39) I161N probably damaging Het
Zfp474 A T 18: 52,772,015 (GRCm39) I223F probably damaging Het
Zfp583 A G 7: 6,320,328 (GRCm39) L228P probably damaging Het
Zfyve27 A G 19: 42,165,856 (GRCm39) T76A possibly damaging Het
Other mutations in Cramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1 APN 17 25,202,925 (GRCm39) missense probably benign 0.11
IGL01360:Cramp1 APN 17 25,216,547 (GRCm39) missense probably damaging 1.00
IGL01966:Cramp1 APN 17 25,201,917 (GRCm39) missense probably benign 0.01
IGL02211:Cramp1 APN 17 25,196,610 (GRCm39) missense possibly damaging 0.94
IGL02474:Cramp1 APN 17 25,204,024 (GRCm39) missense probably damaging 0.98
IGL02798:Cramp1 APN 17 25,187,894 (GRCm39) splice site probably benign
IGL03340:Cramp1 APN 17 25,192,516 (GRCm39) missense probably damaging 1.00
Interred UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R0106:Cramp1 UTSW 17 25,191,350 (GRCm39) missense probably benign 0.30
R1054:Cramp1 UTSW 17 25,202,151 (GRCm39) missense probably damaging 1.00
R1220:Cramp1 UTSW 17 25,201,211 (GRCm39) missense probably damaging 1.00
R1341:Cramp1 UTSW 17 25,196,514 (GRCm39) missense probably damaging 1.00
R1491:Cramp1 UTSW 17 25,191,323 (GRCm39) missense probably benign 0.17
R1610:Cramp1 UTSW 17 25,202,925 (GRCm39) missense probably benign 0.11
R1649:Cramp1 UTSW 17 25,202,217 (GRCm39) missense probably damaging 1.00
R1795:Cramp1 UTSW 17 25,183,884 (GRCm39) missense probably damaging 1.00
R1856:Cramp1 UTSW 17 25,187,952 (GRCm39) missense probably damaging 1.00
R1881:Cramp1 UTSW 17 25,196,656 (GRCm39) splice site probably benign
R1968:Cramp1 UTSW 17 25,183,913 (GRCm39) missense probably damaging 1.00
R2047:Cramp1 UTSW 17 25,222,189 (GRCm39) nonsense probably null
R2099:Cramp1 UTSW 17 25,192,059 (GRCm39) missense probably benign 0.01
R2298:Cramp1 UTSW 17 25,216,454 (GRCm39) missense probably damaging 0.96
R3752:Cramp1 UTSW 17 25,190,532 (GRCm39) missense probably damaging 1.00
R3821:Cramp1 UTSW 17 25,193,756 (GRCm39) missense probably damaging 1.00
R3861:Cramp1 UTSW 17 25,216,588 (GRCm39) splice site probably benign
R4399:Cramp1 UTSW 17 25,198,559 (GRCm39) missense probably damaging 1.00
R4847:Cramp1 UTSW 17 25,204,063 (GRCm39) missense probably damaging 1.00
R4883:Cramp1 UTSW 17 25,201,293 (GRCm39) missense probably benign
R5579:Cramp1 UTSW 17 25,192,087 (GRCm39) missense possibly damaging 0.89
R5631:Cramp1 UTSW 17 25,204,577 (GRCm39) missense possibly damaging 0.93
R5716:Cramp1 UTSW 17 25,193,709 (GRCm39) missense probably damaging 0.99
R6589:Cramp1 UTSW 17 25,196,466 (GRCm39) splice site probably null
R6631:Cramp1 UTSW 17 25,202,931 (GRCm39) missense probably benign 0.40
R7307:Cramp1 UTSW 17 25,193,719 (GRCm39) missense possibly damaging 0.94
R7323:Cramp1 UTSW 17 25,201,379 (GRCm39) missense possibly damaging 0.90
R7672:Cramp1 UTSW 17 25,201,440 (GRCm39) missense probably damaging 0.96
R7832:Cramp1 UTSW 17 25,202,196 (GRCm39) missense probably damaging 0.96
R8071:Cramp1 UTSW 17 25,201,674 (GRCm39) missense probably damaging 0.99
R8244:Cramp1 UTSW 17 25,190,384 (GRCm39) missense probably damaging 1.00
R8430:Cramp1 UTSW 17 25,196,536 (GRCm39) missense probably damaging 1.00
R8783:Cramp1 UTSW 17 25,193,732 (GRCm39) missense probably damaging 0.99
R8890:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8892:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8894:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8937:Cramp1 UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R8941:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R9029:Cramp1 UTSW 17 25,232,884 (GRCm39) missense probably damaging 1.00
R9047:Cramp1 UTSW 17 25,198,603 (GRCm39) missense possibly damaging 0.90
R9149:Cramp1 UTSW 17 25,187,920 (GRCm39) missense probably damaging 0.99
R9262:Cramp1 UTSW 17 25,232,920 (GRCm39) missense probably damaging 0.99
R9460:Cramp1 UTSW 17 25,222,281 (GRCm39) missense probably damaging 1.00
R9614:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9615:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9651:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9653:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9665:Cramp1 UTSW 17 25,196,545 (GRCm39) missense probably damaging 1.00
R9753:Cramp1 UTSW 17 25,191,320 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCTGACTGAAGCCTGGTGTC -3'
(R):5'- AAGTCTGAGCAGCCCAGATG -3'

Sequencing Primer
(F):5'- CAGGTTGATGATCAGTGCCAG -3'
(R):5'- CCAGATGCCCCCGACAG -3'
Posted On 2022-11-14