Incidental Mutation 'R9652:Zfp474'
ID 735421
Institutional Source Beutler Lab
Gene Symbol Zfp474
Ensembl Gene ENSMUSG00000046886
Gene Name zinc finger protein 474
Synonyms 4933409D10Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9652 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 52748987-52772902 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52772015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 223 (I223F)
Ref Sequence ENSEMBL: ENSMUSP00000072453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072666] [ENSMUST00000209270]
AlphaFold Q6V5K9
Predicted Effect probably damaging
Transcript: ENSMUST00000072666
AA Change: I223F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072453
Gene: ENSMUSG00000046886
AA Change: I223F

DomainStartEndE-ValueType
Pfam:zf-C2HC_2 90 114 1.8e-10 PFAM
Pfam:zf-C2HC_2 161 185 3.3e-13 PFAM
Pfam:zf-C2HC_2 217 241 1.2e-10 PFAM
low complexity region 250 267 N/A INTRINSIC
Pfam:zf-C2HC_2 280 304 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209270
AA Change: I223F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 G A 18: 61,876,432 (GRCm39) T395M probably damaging Het
Akap8l T C 17: 32,557,783 (GRCm39) N35D probably damaging Het
Atr T A 9: 95,756,887 (GRCm39) L922Q probably damaging Het
B3gnt9 G T 8: 105,981,129 (GRCm39) F86L probably damaging Het
Bmp1 T C 14: 70,715,360 (GRCm39) D925G probably damaging Het
Camkmt A T 17: 85,759,713 (GRCm39) R284S probably benign Het
Cavin3 G T 7: 105,131,304 (GRCm39) H21Q probably damaging Het
Ccp110 A G 7: 118,334,553 (GRCm39) H180R Het
Cdh23 A T 10: 60,167,135 (GRCm39) V1837E probably damaging Het
Ces3b G T 8: 105,812,257 (GRCm39) A169S probably damaging Het
Chpt1 T C 10: 88,325,499 (GRCm39) N122S probably benign Het
Cramp1 C A 17: 25,201,783 (GRCm39) K566N probably damaging Het
Ctbp2 C G 7: 132,615,933 (GRCm39) R334P probably damaging Het
Cwh43 T C 5: 73,572,340 (GRCm39) S193P probably benign Het
Dcstamp A T 15: 39,623,792 (GRCm39) D469V probably benign Het
Dst T A 1: 34,219,458 (GRCm39) I1966N probably benign Het
Eif3i G T 4: 129,489,094 (GRCm39) F121L probably benign Het
Erbb2 T C 11: 98,326,812 (GRCm39) S1074P probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbn2 A G 18: 58,146,722 (GRCm39) probably null Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Gm2a T C 11: 54,999,764 (GRCm39) V95A probably benign Het
Gp5 A C 16: 30,128,393 (GRCm39) F94V probably damaging Het
Gramd4 G A 15: 86,016,160 (GRCm39) E504K probably damaging Het
Gusb A G 5: 130,026,652 (GRCm39) S450P probably damaging Het
Htr5a A G 5: 28,047,838 (GRCm39) N131S possibly damaging Het
Itga2 G A 13: 115,020,991 (GRCm39) P120L probably benign Het
Itpkb G T 1: 180,160,056 (GRCm39) E61* probably null Het
Katnbl1 T A 2: 112,239,497 (GRCm39) V232D probably damaging Het
Kifap3 T C 1: 163,689,657 (GRCm39) L547P probably damaging Het
Krt6a C T 15: 101,599,120 (GRCm39) V482M probably benign Het
Lrfn5 T A 12: 61,890,418 (GRCm39) V569D probably damaging Het
Luzp2 A G 7: 54,702,580 (GRCm39) T48A probably damaging Het
Mical2 G T 7: 111,945,996 (GRCm39) R986L probably damaging Het
Mroh8 G A 2: 157,094,970 (GRCm39) Q339* probably null Het
Msln A T 17: 25,968,042 (GRCm39) V541E probably damaging Het
Muc16 T A 9: 18,498,178 (GRCm39) M6590L probably benign Het
Nhsl3 T C 4: 129,117,962 (GRCm39) E279G possibly damaging Het
Nisch A T 14: 30,893,628 (GRCm39) V1315E probably damaging Het
Nubp2 G A 17: 25,103,382 (GRCm39) T165I probably damaging Het
Oog3 T G 4: 143,884,489 (GRCm39) R482S probably benign Het
Or2a7 A G 6: 43,150,991 (GRCm39) M24V probably benign Het
Or56a42-ps1 A T 7: 104,775,985 (GRCm39) N164K probably benign Het
Or6c33 T C 10: 129,853,809 (GRCm39) I193T possibly damaging Het
Or7a41 T C 10: 78,871,230 (GRCm39) I200T probably benign Het
Or8k39 A T 2: 86,563,636 (GRCm39) F107I probably damaging Het
P3h4 A T 11: 100,304,499 (GRCm39) C247* probably null Het
Pakap G A 4: 57,710,125 (GRCm39) A357T possibly damaging Het
Plch2 T A 4: 155,082,942 (GRCm39) M569L probably benign Het
Plcl1 A G 1: 55,735,450 (GRCm39) T264A probably benign Het
Rad51ap1 G T 6: 126,904,526 (GRCm39) N178K probably benign Het
Rasa4 T C 5: 136,130,494 (GRCm39) L340P probably damaging Het
Rassf10 A G 7: 112,554,784 (GRCm39) T462A probably benign Het
Rlf G C 4: 121,007,865 (GRCm39) L482V probably damaging Het
Robo1 T G 16: 72,821,330 (GRCm39) S1357A possibly damaging Het
Rp1l1 T C 14: 64,269,714 (GRCm39) S1767P probably damaging Het
Rpl3l T A 17: 24,947,328 (GRCm39) L14Q probably damaging Het
Ryr3 T A 2: 112,635,047 (GRCm39) T2024S possibly damaging Het
Sbf2 T C 7: 110,040,702 (GRCm39) Q375R possibly damaging Het
Sema6a T C 18: 47,382,252 (GRCm39) Q765R probably damaging Het
Senp6 T A 9: 80,021,228 (GRCm39) Y303N probably damaging Het
Sertad4 C T 1: 192,528,836 (GRCm39) D327N probably damaging Het
Slc22a15 T A 3: 101,790,848 (GRCm39) Y219F possibly damaging Het
Slco1b2 T G 6: 141,594,358 (GRCm39) probably null Het
Snrnp200 G T 2: 127,067,959 (GRCm39) V819L probably damaging Het
Ssb C A 2: 69,700,784 (GRCm39) A288E probably damaging Het
Syne2 A G 12: 76,101,620 (GRCm39) H638R probably benign Het
Tm7sf3 A G 6: 146,527,698 (GRCm39) S43P probably benign Het
Tmem200c A G 17: 69,149,181 (GRCm39) H588R probably benign Het
Tnpo3 G A 6: 29,560,173 (GRCm39) R657* probably null Het
Traf6 T C 2: 101,518,927 (GRCm39) C139R probably damaging Het
Txnrd1 C A 10: 82,720,390 (GRCm39) N424K possibly damaging Het
Ubqln3 T C 7: 103,791,962 (GRCm39) I43V probably damaging Het
Usp32 A G 11: 84,921,317 (GRCm39) V699A probably damaging Het
Vmn2r103 T C 17: 20,014,027 (GRCm39) V273A probably benign Het
Vmn2r8 A G 5: 108,951,107 (GRCm39) S113P probably benign Het
Wdr7 T A 18: 63,860,826 (GRCm39) I161N probably damaging Het
Zfp583 A G 7: 6,320,328 (GRCm39) L228P probably damaging Het
Zfyve27 A G 19: 42,165,856 (GRCm39) T76A possibly damaging Het
Other mutations in Zfp474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp474 APN 18 52,771,565 (GRCm39) missense possibly damaging 0.52
IGL01651:Zfp474 APN 18 52,771,655 (GRCm39) missense probably damaging 1.00
IGL01750:Zfp474 APN 18 52,772,349 (GRCm39) missense possibly damaging 0.59
IGL02013:Zfp474 APN 18 52,771,971 (GRCm39) missense possibly damaging 0.86
PIT4469001:Zfp474 UTSW 18 52,771,791 (GRCm39) missense possibly damaging 0.77
PIT4618001:Zfp474 UTSW 18 52,771,476 (GRCm39) missense probably damaging 0.97
R0615:Zfp474 UTSW 18 52,771,421 (GRCm39) missense probably benign 0.02
R1178:Zfp474 UTSW 18 52,771,814 (GRCm39) nonsense probably null
R1180:Zfp474 UTSW 18 52,771,814 (GRCm39) nonsense probably null
R1610:Zfp474 UTSW 18 52,771,437 (GRCm39) missense probably benign
R1819:Zfp474 UTSW 18 52,771,872 (GRCm39) missense probably damaging 1.00
R4854:Zfp474 UTSW 18 52,771,503 (GRCm39) missense possibly damaging 0.59
R6270:Zfp474 UTSW 18 52,771,436 (GRCm39) missense probably benign
R7574:Zfp474 UTSW 18 52,772,261 (GRCm39) missense probably benign 0.00
R8194:Zfp474 UTSW 18 52,772,229 (GRCm39) missense probably damaging 1.00
R8799:Zfp474 UTSW 18 52,772,166 (GRCm39) missense probably benign 0.00
R9407:Zfp474 UTSW 18 52,771,502 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ATTTCAGAGTGCTCAGGCTCAG -3'
(R):5'- CACAATTTGGGCAAGGCAC -3'

Sequencing Primer
(F):5'- TGCTGCCCTGTGAAAACTG -3'
(R):5'- TGGGCAAGGCACAAGTG -3'
Posted On 2022-11-14