Incidental Mutation 'R9652:Afap1l1'
ID 735423
Institutional Source Beutler Lab
Gene Symbol Afap1l1
Ensembl Gene ENSMUSG00000033032
Gene Name actin filament associated protein 1-like 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9652 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 61730261-61786702 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 61743361 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 395 (T395M)
Ref Sequence ENSEMBL: ENSMUSP00000113286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120472] [ENSMUST00000154876]
AlphaFold Q8BZI0
Predicted Effect probably damaging
Transcript: ENSMUST00000120472
AA Change: T395M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113286
Gene: ENSMUSG00000033032
AA Change: T395M

DomainStartEndE-ValueType
low complexity region 114 123 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
PH 221 318 4.13e-6 SMART
PH 419 514 9.41e-10 SMART
coiled coil region 611 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154876
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l T C 17: 32,338,809 N35D probably damaging Het
Atr T A 9: 95,874,834 L922Q probably damaging Het
B3gnt9 G T 8: 105,254,497 F86L probably damaging Het
Bmp1 T C 14: 70,477,920 D925G probably damaging Het
C77080 T C 4: 129,224,169 E279G possibly damaging Het
Camkmt A T 17: 85,452,285 R284S probably benign Het
Cavin3 G T 7: 105,482,097 H21Q probably damaging Het
Ccp110 A G 7: 118,735,330 H180R Het
Cdh23 A T 10: 60,331,356 V1837E probably damaging Het
Ces3b G T 8: 105,085,625 A169S probably damaging Het
Chpt1 T C 10: 88,489,637 N122S probably benign Het
Cramp1l C A 17: 24,982,809 K566N probably damaging Het
Ctbp2 C G 7: 133,014,204 R334P probably damaging Het
Cwh43 T C 5: 73,414,997 S193P probably benign Het
Dcstamp A T 15: 39,760,396 D469V probably benign Het
Dst T A 1: 34,180,377 I1966N probably benign Het
Eif3i G T 4: 129,595,301 F121L probably benign Het
Erbb2 T C 11: 98,435,986 S1074P probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbn2 A G 18: 58,013,650 probably null Het
Foxo3 C T 10: 42,197,025 V499M probably damaging Het
Gm2a T C 11: 55,108,938 V95A probably benign Het
Gp5 A C 16: 30,309,575 F94V probably damaging Het
Gramd4 G A 15: 86,131,959 E504K probably damaging Het
Gusb A G 5: 129,997,811 S450P probably damaging Het
Htr5a A G 5: 27,842,840 N131S possibly damaging Het
Itga2 G A 13: 114,884,455 P120L probably benign Het
Itpkb G T 1: 180,332,491 E61* probably null Het
Katnbl1 T A 2: 112,409,152 V232D probably damaging Het
Kifap3 T C 1: 163,862,088 L547P probably damaging Het
Krt6a C T 15: 101,690,685 V482M probably benign Het
Lrfn5 T A 12: 61,843,632 V569D probably damaging Het
Luzp2 A G 7: 55,052,832 T48A probably damaging Het
Mical2 G T 7: 112,346,789 R986L probably damaging Het
Mroh8 G A 2: 157,253,050 Q339* probably null Het
Msln A T 17: 25,749,068 V541E probably damaging Het
Muc16 T A 9: 18,586,882 M6590L probably benign Het
Nisch A T 14: 31,171,671 V1315E probably damaging Het
Nubp2 G A 17: 24,884,408 T165I probably damaging Het
Olfr1089 A T 2: 86,733,292 F107I probably damaging Het
Olfr13 A G 6: 43,174,057 M24V probably benign Het
Olfr57 T C 10: 79,035,396 I200T probably benign Het
Olfr682-ps1 A T 7: 105,126,778 N164K probably benign Het
Olfr820 T C 10: 130,017,940 I193T possibly damaging Het
Oog3 T G 4: 144,157,919 R482S probably benign Het
P3h4 A T 11: 100,413,673 C247* probably null Het
Palm2 G A 4: 57,710,125 A357T possibly damaging Het
Plch2 T A 4: 154,998,485 M569L probably benign Het
Plcl1 A G 1: 55,696,291 T264A probably benign Het
Rad51ap1 G T 6: 126,927,563 N178K probably benign Het
Rasa4 T C 5: 136,101,640 L340P probably damaging Het
Rassf10 A G 7: 112,955,577 T462A probably benign Het
Rlf G C 4: 121,150,668 L482V probably damaging Het
Robo1 T G 16: 73,024,442 S1357A possibly damaging Het
Rp1l1 T C 14: 64,032,265 S1767P probably damaging Het
Rpl3l T A 17: 24,728,354 L14Q probably damaging Het
Ryr3 T A 2: 112,804,702 T2024S possibly damaging Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sema6a T C 18: 47,249,185 Q765R probably damaging Het
Senp6 T A 9: 80,113,946 Y303N probably damaging Het
Sertad4 C T 1: 192,846,528 D327N probably damaging Het
Slc22a15 T A 3: 101,883,532 Y219F possibly damaging Het
Slco1b2 T G 6: 141,648,632 probably null Het
Snrnp200 G T 2: 127,226,039 V819L probably damaging Het
Ssb C A 2: 69,870,440 A288E probably damaging Het
Syne2 A G 12: 76,054,846 H638R probably benign Het
Tm7sf3 A G 6: 146,626,200 S43P probably benign Het
Tmem200c A G 17: 68,842,186 H588R probably benign Het
Tnpo3 G A 6: 29,560,174 R657* probably null Het
Traf6 T C 2: 101,688,582 C139R probably damaging Het
Txnrd1 C A 10: 82,884,556 N424K possibly damaging Het
Ubqln3 T C 7: 104,142,755 I43V probably damaging Het
Usp32 A G 11: 85,030,491 V699A probably damaging Het
Vmn2r103 T C 17: 19,793,765 V273A probably benign Het
Vmn2r8 A G 5: 108,803,241 S113P probably benign Het
Wdr7 T A 18: 63,727,755 I161N probably damaging Het
Zfp474 A T 18: 52,638,943 I223F probably damaging Het
Zfp583 A G 7: 6,317,329 L228P probably damaging Het
Zfyve27 A G 19: 42,177,417 T76A possibly damaging Het
Other mutations in Afap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Afap1l1 APN 18 61736854 missense probably benign 0.04
IGL01643:Afap1l1 APN 18 61751826 missense probably damaging 1.00
IGL01754:Afap1l1 APN 18 61737494 critical splice donor site probably null
IGL01945:Afap1l1 APN 18 61756863 missense probably benign 0.00
IGL02025:Afap1l1 APN 18 61733699 splice site probably benign
IGL02413:Afap1l1 APN 18 61733789 missense probably benign 0.00
IGL02418:Afap1l1 APN 18 61752577 missense probably damaging 1.00
IGL02493:Afap1l1 APN 18 61737523 missense possibly damaging 0.83
IGL02888:Afap1l1 APN 18 61748808 missense probably damaging 1.00
IGL03010:Afap1l1 APN 18 61743319 missense probably benign 0.01
IGL03122:Afap1l1 APN 18 61733831 missense probably benign
IGL03145:Afap1l1 APN 18 61741809 missense possibly damaging 0.93
IGL03052:Afap1l1 UTSW 18 61748823 missense probably benign 0.00
R0008:Afap1l1 UTSW 18 61756905 missense probably benign 0.11
R0008:Afap1l1 UTSW 18 61756905 missense probably benign 0.11
R0217:Afap1l1 UTSW 18 61746869 missense probably damaging 1.00
R0421:Afap1l1 UTSW 18 61751874 missense probably damaging 1.00
R0626:Afap1l1 UTSW 18 61739220 missense probably benign 0.07
R0963:Afap1l1 UTSW 18 61736930 missense probably damaging 1.00
R1403:Afap1l1 UTSW 18 61741838 missense probably damaging 1.00
R1403:Afap1l1 UTSW 18 61741838 missense probably damaging 1.00
R1566:Afap1l1 UTSW 18 61755643 missense probably benign
R1572:Afap1l1 UTSW 18 61737499 missense probably damaging 1.00
R1854:Afap1l1 UTSW 18 61743294 missense probably benign
R1992:Afap1l1 UTSW 18 61741771 nonsense probably null
R2063:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2064:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2065:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R2066:Afap1l1 UTSW 18 61739122 critical splice donor site probably null
R4120:Afap1l1 UTSW 18 61739172 missense probably damaging 1.00
R4904:Afap1l1 UTSW 18 61738715 missense probably benign 0.00
R4997:Afap1l1 UTSW 18 61751808 missense probably benign
R5379:Afap1l1 UTSW 18 61758650 missense probably damaging 1.00
R5947:Afap1l1 UTSW 18 61743700 missense probably damaging 0.98
R6774:Afap1l1 UTSW 18 61755661 missense probably benign 0.00
R6814:Afap1l1 UTSW 18 61733741 missense probably benign 0.45
R7085:Afap1l1 UTSW 18 61748814 missense possibly damaging 0.91
R7325:Afap1l1 UTSW 18 61736846 missense probably benign 0.44
R7543:Afap1l1 UTSW 18 61756901 missense probably benign 0.01
R7877:Afap1l1 UTSW 18 61746782 missense probably damaging 1.00
R8041:Afap1l1 UTSW 18 61758683 missense probably damaging 1.00
R8253:Afap1l1 UTSW 18 61741631 missense probably benign 0.43
R8913:Afap1l1 UTSW 18 61756839 critical splice donor site probably null
R9443:Afap1l1 UTSW 18 61746788 missense probably damaging 1.00
R9521:Afap1l1 UTSW 18 61746792 missense probably benign
R9633:Afap1l1 UTSW 18 61757724 missense possibly damaging 0.62
R9792:Afap1l1 UTSW 18 61741751 missense possibly damaging 0.94
R9793:Afap1l1 UTSW 18 61741751 missense possibly damaging 0.94
R9795:Afap1l1 UTSW 18 61741751 missense possibly damaging 0.94
Z1177:Afap1l1 UTSW 18 61752508 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGCATGGAGAGTTCCCTG -3'
(R):5'- CAGGTCCACAGTAACAGAGCAG -3'

Sequencing Primer
(F):5'- TGGAACTTGCCCCAGGAG -3'
(R):5'- ATATCTAGTAATTACAGGCAGGTTGC -3'
Posted On 2022-11-14