Mutagenetix > Incidental Mutation

Incidental Mutation 'R9658:Tns1'

735513

Institutional Source

Beutler Lab

Gene Symbol

Tns1

Ensembl Gene

ENSMUSG00000055322

Gene Name

tensin 1

Synonyms

1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.442) question?

Stock #

R9658 (G1)

Quality Score

215.009

Status

Not validated

Chromosome

Chromosomal Location

73910231-74124449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 73942023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Glutamic Acid at position 1061 (Q1061E)

Ref Sequence

ENSEMBL: ENSMUSP00000127715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000191104] [ENSMUST00000212888]

AlphaFold

E9Q0S6

Predicted Effect

probably benign
Transcript: ENSMUST00000169786
AA Change: Q1061E

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: Q1061E

Domain	Start	End	E-Value	Type
low complexity region	15	33	N/A	INTRINSIC
C1	62	108	1.77e-2	SMART
low complexity region	154	167	N/A	INTRINSIC
SCOP:d1d5ra2	176	348	3e-32	SMART
PTEN_C2	350	477	1.12e-51	SMART
low complexity region	822	833	N/A	INTRINSIC
low complexity region	905	922	N/A	INTRINSIC
low complexity region	1227	1239	N/A	INTRINSIC
low complexity region	1284	1300	N/A	INTRINSIC
low complexity region	1459	1470	N/A	INTRINSIC
low complexity region	1518	1530	N/A	INTRINSIC
SH2	1614	1716	6.85e-17	SMART
PTB	1747	1888	1.69e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187584
AA Change: Q1017E

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: Q1017E

Domain	Start	End	E-Value	Type
C1	21	67	8.6e-5	SMART
low complexity region	113	124	N/A	INTRINSIC
PTPc_DSPc	197	319	9.9e-6	SMART
PTEN_C2	306	433	5.6e-56	SMART
low complexity region	778	789	N/A	INTRINSIC
low complexity region	861	878	N/A	INTRINSIC
low complexity region	1162	1174	N/A	INTRINSIC
low complexity region	1219	1235	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1453	1465	N/A	INTRINSIC
SH2	1549	1651	4.3e-19	SMART
PTB	1682	1823	9e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189228

Predicted Effect

probably benign
Transcript: ENSMUST00000191104
AA Change: Q1061E

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: Q1061E

Domain	Start	End	E-Value	Type
low complexity region	15	33	N/A	INTRINSIC
C1	62	108	8.6e-5	SMART
low complexity region	154	167	N/A	INTRINSIC
PTPc_DSPc	241	363	9.9e-6	SMART
PTEN_C2	350	477	5.6e-56	SMART
low complexity region	822	833	N/A	INTRINSIC
low complexity region	905	922	N/A	INTRINSIC
low complexity region	1206	1218	N/A	INTRINSIC
low complexity region	1263	1279	N/A	INTRINSIC
low complexity region	1438	1449	N/A	INTRINSIC
low complexity region	1497	1509	N/A	INTRINSIC
SH2	1593	1695	4.3e-19	SMART
PTB	1726	1867	9e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212888
AA Change: Q1061E

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.4%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	C	T	18: 70,467,330		probably null	Het
Abca12	T	C	1: 71,286,475	I1521M	probably damaging	Het
Abcc3	A	G	11: 94,372,877	S268P	possibly damaging	Het
Adamts20	G	C	15: 94,351,745	P464A	probably damaging	Het
Apoa1	C	A	9: 46,229,982	D125E	probably benign	Het
Atp6v0a1	C	A	11: 101,018,588	Q48K	probably benign	Het
Bptf	T	C	11: 107,111,344	N314S	probably damaging	Het
Cdh7	T	C	1: 110,061,055	V229A	probably damaging	Het
Cfap46	G	A	7: 139,666,313	T378M		Het
Clca3b	T	A	3: 144,837,814	D418V	probably damaging	Het
Dennd4c	T	A	4: 86,836,388	L1545*	probably null	Het
Dnajc13	A	G	9: 104,238,529	V27A	probably benign	Het
Eif2ak2	A	T	17: 78,876,203	D72E	probably benign	Het
Eif2ak4	T	C	2: 118,439,030	I862T	probably damaging	Het
Eif4g1	T	C	16: 20,684,113	I1022T	probably benign	Het
Enpp3	A	T	10: 24,773,904	*875R	probably null	Het
F11	T	C	8: 45,245,634	Y491C	probably damaging	Het
Fam155a	T	C	8: 9,770,114	D302G	probably benign	Het
Fam98c	A	C	7: 29,152,781	W118G	probably damaging	Het
Fbxo43	A	T	15: 36,152,136	L509Q	probably damaging	Het
Fbxw5	A	G	2: 25,503,858	H366R	probably damaging	Het
Flt1	G	T	5: 147,588,567	N920K	probably damaging	Het
Git1	T	A	11: 77,499,755	F106I	probably damaging	Het
Glipr1l2	A	G	10: 112,106,963	E241G	probably damaging	Het
Gm11639	A	G	11: 104,720,294	K321E	probably benign	Het
Gm2381	A	C	7: 42,820,305	C132G	probably damaging	Het
Gm49383	A	G	12: 69,192,854	I237T		Het
Gm7324	T	A	14: 43,714,825	D308E	probably benign	Het
Gpr17	A	G	18: 31,947,368	L214P	probably damaging	Het
Gtf3c1	A	T	7: 125,707,562	L39Q	probably damaging	Het
H2-Q6	C	T	17: 35,425,209	R56C	probably damaging	Het
Hcar2	T	C	5: 123,864,469	T324A	possibly damaging	Het
Ksr2	T	C	5: 117,747,360	S750P	probably damaging	Het
Lipi	C	A	16: 75,560,801	R292L	probably benign	Het
Map4k3	C	A	17: 80,653,877	M133I	probably benign	Het
Marf1	A	T	16: 14,140,223	L805Q	probably damaging	Het
Mccc2	T	A	13: 99,954,246	R460W	probably damaging	Het
Mgam	A	G	6: 40,744,377	D312G	possibly damaging	Het
Nadk2	A	T	15: 9,103,361	K360*	probably null	Het
Nars2	A	G	7: 97,039,971	I367V	probably benign	Het
Nppb	T	C	4: 147,986,494	S109P	possibly damaging	Het
Odf2	G	A	2: 29,889,801	R15Q	probably benign	Het
Olfr1312	C	A	2: 112,042,478	A185S	probably damaging	Het
Olfr209	A	T	16: 59,361,743	H158Q	probably damaging	Het
Olfr630	C	T	7: 103,754,821	V255M	probably damaging	Het
Osbpl1a	A	T	18: 12,756,212	I949N	probably benign	Het
Pan3	T	C	5: 147,543,071	F55L	probably benign	Het
Patj	A	G	4: 98,465,140	D640G	probably null	Het
Pdxk	T	C	10: 78,451,569	K53E	probably benign	Het
Pja2	A	G	17: 64,292,873	S539P	probably damaging	Het
Plscr1	T	A	9: 92,266,482	C158*	probably null	Het
Prdm14	T	C	1: 13,118,921	T400A	probably benign	Het
Rag1	C	T	2: 101,642,884	V638M	possibly damaging	Het
Ros1	A	G	10: 52,090,973	S1734P	probably damaging	Het
S100a9	T	C	3: 90,692,774	H105R	unknown	Het
Shisa9	A	T	16: 12,244,656	Q247L	possibly damaging	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc27a4	G	A	2: 29,811,289	R364Q	probably damaging	Het
Spag17	C	T	3: 100,027,616	P713S	possibly damaging	Het
Tbc1d4	T	A	14: 101,608,420	H14L	probably damaging	Het
Tmem144	T	A	3: 79,822,684	Y253F	probably damaging	Het
Tmem204	C	T	17: 25,080,348	G66R	possibly damaging	Het
Tnfrsf1b	A	T	4: 145,215,854	V453E	probably damaging	Het
Trav5-1	A	G	14: 52,622,971	K78E	probably benign	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Usp17lc	G	A	7: 103,418,182	G228D	possibly damaging	Het
Uvssa	T	C	5: 33,410,989	C574R	probably damaging	Het
Veph1	G	A	3: 66,264,013	Q3*	probably null	Het
Vps13b	T	A	15: 35,623,628	D1230E	probably benign	Het
Xkr9	T	A	1: 13,701,094	I278N	probably damaging	Het
Zbed4	C	A	15: 88,780,539	A270E	probably benign	Het
Zfp366	A	T	13: 99,228,927	T199S	probably benign	Het

Other mutations in Tns1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Tns1	APN	1	73924969	missense	probably damaging	0.99
IGL01288:Tns1	APN	1	73953810	missense	probably damaging	1.00
IGL01536:Tns1	APN	1	73919648	splice site	probably benign
IGL01568:Tns1	APN	1	73953509	missense	probably damaging	1.00
IGL01683:Tns1	APN	1	73953269	missense	probably damaging	0.98
IGL02267:Tns1	APN	1	73992131	missense	possibly damaging	0.95
IGL02597:Tns1	APN	1	73985873	critical splice donor site	probably null
IGL02819:Tns1	APN	1	73937248	missense	probably damaging	0.99
IGL03370:Tns1	APN	1	73985894	missense	probably damaging	1.00
R0087:Tns1	UTSW	1	73916917	missense	possibly damaging	0.95
R0207:Tns1	UTSW	1	73937318	critical splice acceptor site	probably null
R0411:Tns1	UTSW	1	73925761	missense	probably damaging	0.96
R0543:Tns1	UTSW	1	73952697	missense	probably benign	0.01
R0552:Tns1	UTSW	1	73920563	missense	probably damaging	1.00
R0720:Tns1	UTSW	1	73925581	missense	probably benign	0.03
R0828:Tns1	UTSW	1	73919666	missense	probably damaging	1.00
R1034:Tns1	UTSW	1	73941969	missense	probably damaging	1.00
R1061:Tns1	UTSW	1	73917672	missense	probably damaging	1.00
R1819:Tns1	UTSW	1	73916476	splice site	probably benign
R1826:Tns1	UTSW	1	73953634	start codon destroyed	probably null	0.91
R2208:Tns1	UTSW	1	74079240	missense	probably damaging	1.00
R3723:Tns1	UTSW	1	73924940	missense	probably damaging	0.99
R4079:Tns1	UTSW	1	73995308	missense	probably damaging	1.00
R4111:Tns1	UTSW	1	73941932	missense	probably damaging	1.00
R4155:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4156:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4157:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4274:Tns1	UTSW	1	73928098	missense	probably damaging	1.00
R4426:Tns1	UTSW	1	73985749	missense	probably damaging	0.97
R4649:Tns1	UTSW	1	73953771	missense	probably damaging	1.00
R4742:Tns1	UTSW	1	74124290	critical splice donor site	probably null
R4869:Tns1	UTSW	1	73952615	missense	probably benign
R4961:Tns1	UTSW	1	73935915	missense	probably benign	0.35
R5025:Tns1	UTSW	1	73925482	missense	probably damaging	1.00
R5035:Tns1	UTSW	1	73953820	start gained	probably benign
R5062:Tns1	UTSW	1	73952864	missense	probably damaging	1.00
R5080:Tns1	UTSW	1	73952940	missense	probably damaging	1.00
R5213:Tns1	UTSW	1	73953612	missense	probably damaging	1.00
R5256:Tns1	UTSW	1	73995426	intron	probably benign
R5368:Tns1	UTSW	1	73941017	missense	probably benign	0.07
R5391:Tns1	UTSW	1	73990409	splice site	probably null
R5587:Tns1	UTSW	1	73920596	missense	possibly damaging	0.94
R5735:Tns1	UTSW	1	73927979	missense	probably benign	0.00
R5855:Tns1	UTSW	1	73918033	missense	possibly damaging	0.83
R5999:Tns1	UTSW	1	73928097	nonsense	probably null
R6122:Tns1	UTSW	1	73952419	critical splice donor site	probably null
R6148:Tns1	UTSW	1	73953453	missense	probably damaging	1.00
R6457:Tns1	UTSW	1	73918050	missense	probably damaging	0.99
R6525:Tns1	UTSW	1	73953470	missense	probably damaging	1.00
R6712:Tns1	UTSW	1	74079301	nonsense	probably null
R6773:Tns1	UTSW	1	73919707	missense	probably damaging	1.00
R6825:Tns1	UTSW	1	74002323	nonsense	probably null
R7085:Tns1	UTSW	1	73925462	missense	probably benign	0.00
R7128:Tns1	UTSW	1	73995304	missense
R7209:Tns1	UTSW	1	73953915	missense	possibly damaging	0.68
R7348:Tns1	UTSW	1	73916917	missense	possibly damaging	0.95
R7570:Tns1	UTSW	1	73953479	missense	probably damaging	1.00
R7670:Tns1	UTSW	1	73952477	missense	possibly damaging	0.93
R7769:Tns1	UTSW	1	73953371	missense	probably damaging	0.99
R7833:Tns1	UTSW	1	74091331	intron	probably benign
R8052:Tns1	UTSW	1	73953437	missense	probably damaging	1.00
R8225:Tns1	UTSW	1	73985887	missense	probably damaging	1.00
R8244:Tns1	UTSW	1	73937251	missense	probably damaging	1.00
R8321:Tns1	UTSW	1	73985780	critical splice acceptor site	probably null
R8344:Tns1	UTSW	1	73985042	missense	probably damaging	1.00
R8378:Tns1	UTSW	1	73937246	missense	probably damaging	1.00
R8434:Tns1	UTSW	1	73925606	missense	probably benign	0.00
R8773:Tns1	UTSW	1	73937248	missense	probably damaging	0.99
R9211:Tns1	UTSW	1	73917789	missense	possibly damaging	0.63
R9251:Tns1	UTSW	1	73991696	missense	probably damaging	1.00
R9315:Tns1	UTSW	1	73940982	missense
R9411:Tns1	UTSW	1	73953503	missense	probably damaging	1.00
R9592:Tns1	UTSW	1	73990394	missense	probably damaging	1.00
R9658:Tns1	UTSW	1	73942024	missense	probably benign	0.08
Z1177:Tns1	UTSW	1	74002307	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- AGATGCCCAATGGACTCTGC -3'
(R):5'- GTTTGAGCTAAGTTGGGAACAG -3'

Sequencing Primer
(F):5'- AATGGACTCTGCTCCCTGCTG -3'
(R):5'- ATGTGGCCCACTCCAGTTCAG -3'

Posted On

2022-11-14