Mutagenetix > Incidental Mutation

Incidental Mutation 'R9658:Mgam'

735537

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R9658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40744377 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 312 (D312G)

Ref Sequence

ENSEMBL: ENSMUSP00000144627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000071535

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201148

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202779
AA Change: D312G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: D312G

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	2	170	1.4e-53	PFAM
PD	297	350	1.4e-14	SMART
Pfam:NtCtMGAM_N	361	474	1.5e-26	PFAM
Blast:ANK	514	544	7e-8	BLAST
Pfam:Glyco_hydro_31	562	1064	2.2e-137	PFAM
low complexity region	1149	1164	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202966
AA Change: D193G

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: D193G

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.4%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	C	T	18: 70,467,330		probably null	Het
Abca12	T	C	1: 71,286,475	I1521M	probably damaging	Het
Abcc3	A	G	11: 94,372,877	S268P	possibly damaging	Het
Adamts20	G	C	15: 94,351,745	P464A	probably damaging	Het
Apoa1	C	A	9: 46,229,982	D125E	probably benign	Het
Atp6v0a1	C	A	11: 101,018,588	Q48K	probably benign	Het
Bptf	T	C	11: 107,111,344	N314S	probably damaging	Het
Cdh7	T	C	1: 110,061,055	V229A	probably damaging	Het
Cfap46	G	A	7: 139,666,313	T378M		Het
Clca3b	T	A	3: 144,837,814	D418V	probably damaging	Het
Dennd4c	T	A	4: 86,836,388	L1545*	probably null	Het
Dnajc13	A	G	9: 104,238,529	V27A	probably benign	Het
Eif2ak2	A	T	17: 78,876,203	D72E	probably benign	Het
Eif2ak4	T	C	2: 118,439,030	I862T	probably damaging	Het
Eif4g1	T	C	16: 20,684,113	I1022T	probably benign	Het
Enpp3	A	T	10: 24,773,904	*875R	probably null	Het
F11	T	C	8: 45,245,634	Y491C	probably damaging	Het
Fam155a	T	C	8: 9,770,114	D302G	probably benign	Het
Fam98c	A	C	7: 29,152,781	W118G	probably damaging	Het
Fbxo43	A	T	15: 36,152,136	L509Q	probably damaging	Het
Fbxw5	A	G	2: 25,503,858	H366R	probably damaging	Het
Flt1	G	T	5: 147,588,567	N920K	probably damaging	Het
Git1	T	A	11: 77,499,755	F106I	probably damaging	Het
Glipr1l2	A	G	10: 112,106,963	E241G	probably damaging	Het
Gm11639	A	G	11: 104,720,294	K321E	probably benign	Het
Gm2381	A	C	7: 42,820,305	C132G	probably damaging	Het
Gm49383	A	G	12: 69,192,854	I237T		Het
Gm7324	T	A	14: 43,714,825	D308E	probably benign	Het
Gpr17	A	G	18: 31,947,368	L214P	probably damaging	Het
Gtf3c1	A	T	7: 125,707,562	L39Q	probably damaging	Het
H2-Q6	C	T	17: 35,425,209	R56C	probably damaging	Het
Hcar2	T	C	5: 123,864,469	T324A	possibly damaging	Het
Ksr2	T	C	5: 117,747,360	S750P	probably damaging	Het
Lipi	C	A	16: 75,560,801	R292L	probably benign	Het
Map4k3	C	A	17: 80,653,877	M133I	probably benign	Het
Marf1	A	T	16: 14,140,223	L805Q	probably damaging	Het
Mccc2	T	A	13: 99,954,246	R460W	probably damaging	Het
Nadk2	A	T	15: 9,103,361	K360*	probably null	Het
Nars2	A	G	7: 97,039,971	I367V	probably benign	Het
Nppb	T	C	4: 147,986,494	S109P	possibly damaging	Het
Odf2	G	A	2: 29,889,801	R15Q	probably benign	Het
Olfr1312	C	A	2: 112,042,478	A185S	probably damaging	Het
Olfr209	A	T	16: 59,361,743	H158Q	probably damaging	Het
Olfr630	C	T	7: 103,754,821	V255M	probably damaging	Het
Osbpl1a	A	T	18: 12,756,212	I949N	probably benign	Het
Pan3	T	C	5: 147,543,071	F55L	probably benign	Het
Patj	A	G	4: 98,465,140	D640G	probably null	Het
Pdxk	T	C	10: 78,451,569	K53E	probably benign	Het
Pja2	A	G	17: 64,292,873	S539P	probably damaging	Het
Plscr1	T	A	9: 92,266,482	C158*	probably null	Het
Prdm14	T	C	1: 13,118,921	T400A	probably benign	Het
Rag1	C	T	2: 101,642,884	V638M	possibly damaging	Het
Ros1	A	G	10: 52,090,973	S1734P	probably damaging	Het
S100a9	T	C	3: 90,692,774	H105R	unknown	Het
Shisa9	A	T	16: 12,244,656	Q247L	possibly damaging	Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc27a4	G	A	2: 29,811,289	R364Q	probably damaging	Het
Spag17	C	T	3: 100,027,616	P713S	possibly damaging	Het
Tbc1d4	T	A	14: 101,608,420	H14L	probably damaging	Het
Tmem144	T	A	3: 79,822,684	Y253F	probably damaging	Het
Tmem204	C	T	17: 25,080,348	G66R	possibly damaging	Het
Tnfrsf1b	A	T	4: 145,215,854	V453E	probably damaging	Het
Tns1	G	C	1: 73,942,023	Q1061E	probably benign	Het
Tns1	G	T	1: 73,942,024	N1060K	probably benign	Het
Trav5-1	A	G	14: 52,622,971	K78E	probably benign	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Usp17lc	G	A	7: 103,418,182	G228D	possibly damaging	Het
Uvssa	T	C	5: 33,410,989	C574R	probably damaging	Het
Veph1	G	A	3: 66,264,013	Q3*	probably null	Het
Vps13b	T	A	15: 35,623,628	D1230E	probably benign	Het
Xkr9	T	A	1: 13,701,094	I278N	probably damaging	Het
Zbed4	C	A	15: 88,780,539	A270E	probably benign	Het
Zfp366	A	T	13: 99,228,927	T199S	probably benign	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
BB002:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
BB012:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0452:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1654:Mgam	UTSW	6	40757487	missense	probably damaging	1.00
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2138:Mgam	UTSW	6	40756450	missense	probably damaging	1.00
R2224:Mgam	UTSW	6	40764274	splice site	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	splice site	probably null
R4826:Mgam	UTSW	6	40680648	missense	possibly damaging	0.52
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5770:Mgam	UTSW	6	40669804	missense	probably benign	0.01
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6158:Mgam	UTSW	6	40757714	missense	probably damaging	1.00
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6813:Mgam	UTSW	6	40750165	missense	probably damaging	0.99
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7446:Mgam	UTSW	6	40746332	missense	probably damaging	1.00
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7525:Mgam	UTSW	6	40766020	missense	probably benign	0.01
R7530:Mgam	UTSW	6	40709218	splice site	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7925:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R8206:Mgam	UTSW	6	40680235	missense	probably benign	0.00
R8244:Mgam	UTSW	6	40750586	missense	probably damaging	1.00
R8309:Mgam	UTSW	6	40745177	missense	possibly damaging	0.88
R8472:Mgam	UTSW	6	40694526	splice site	probably null
R8758:Mgam	UTSW	6	40729043	missense	probably benign	0.41
R8777:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8777-TAIL:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8783:Mgam	UTSW	6	40656489	missense	probably damaging	0.99
R8939:Mgam	UTSW	6	40763203	critical splice donor site	probably null
R8968:Mgam	UTSW	6	40757811	critical splice acceptor site	probably null
R8987:Mgam	UTSW	6	40729636	missense	probably damaging	1.00
R9055:Mgam	UTSW	6	40714729	intron	probably benign
R9171:Mgam	UTSW	6	40768212	missense	possibly damaging	0.76
R9252:Mgam	UTSW	6	40729643	missense	probably damaging	0.99
R9258:Mgam	UTSW	6	40680187	missense	probably benign
R9262:Mgam	UTSW	6	40746488	critical splice donor site	probably null
R9287:Mgam	UTSW	6	40728971	intron	probably benign
R9521:Mgam	UTSW	6	40745184	missense	probably damaging	1.00
R9589:Mgam	UTSW	6	40750585	missense	probably damaging	1.00
R9784:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTCTCCTCCTTTAAGACAGC -3'
(R):5'- TGCCCAGTTATGCTCCAATC -3'

Sequencing Primer
(F):5'- CAATGTATCTTGATGGTTGAGACTCC -3'
(R):5'- AATCTTCACCCCATTCCTGAAG -3'

Posted On

2022-11-14